Incidental Mutation 'R3851:Itpkc'
ID 275920
Institutional Source Beutler Lab
Gene Symbol Itpkc
Ensembl Gene ENSMUSG00000003752
Gene Name inositol 1,4,5-trisphosphate 3-kinase C
Synonyms
MMRRC Submission 040899-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.443) question?
Stock # R3851 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 27207172-27228661 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 27227612 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 292 (N292K)
Ref Sequence ENSEMBL: ENSMUSP00000003850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003850]
AlphaFold Q7TS72
Predicted Effect probably benign
Transcript: ENSMUST00000003850
AA Change: N292K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000003850
Gene: ENSMUSG00000003752
AA Change: N292K

DomainStartEndE-ValueType
low complexity region 28 59 N/A INTRINSIC
low complexity region 346 363 N/A INTRINSIC
Pfam:IPK 462 673 3.7e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206441
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inositol 1,4,5-trisphosphate [Ins(1,4,5)P(3)] 3-kinase family of enzymes that catalyze the phosphorylation of inositol 1,4,5-trisphosphate to 1,3,4,5-tetrakisphosphate. The encoded protein is localized to the nucleus and cytoplasm and has both nuclear import and nuclear export activity. Single nucleotide polymorphisms in this gene are associated with Kawasaki disease.[provided by RefSeq, Sep 2009]
PHENOTYPE: No overt phenotype reported. Thymocyte development was normal in homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 G A 7: 101,390,165 W544* probably null Het
AY358078 A G 14: 51,805,553 T233A unknown Het
Bcl9 G A 3: 97,209,653 P575L probably damaging Het
Calcr T C 6: 3,693,735 Y353C probably damaging Het
Cry1 C A 10: 85,146,499 A328S probably benign Het
Dclre1a A T 19: 56,541,507 N799K probably damaging Het
Dnm3 A T 1: 162,321,127 probably null Het
Dock9 A T 14: 121,629,086 probably null Het
Dpysl4 C T 7: 139,100,935 T575M probably damaging Het
Drc7 C T 8: 95,061,836 Q276* probably null Het
Dzip3 T C 16: 48,950,013 T389A possibly damaging Het
Fam196a A G 7: 134,884,526 V432A probably benign Het
Flnc T A 6: 29,453,719 L1801Q probably damaging Het
Fmo9 A G 1: 166,663,367 L463P probably benign Het
Fnip2 G C 3: 79,462,157 H1074D probably damaging Het
Golga2 A G 2: 32,305,611 E806G probably benign Het
H2-Q5 T A 17: 35,394,139 M5K unknown Het
Il27ra C T 8: 84,040,688 E169K probably benign Het
Lhfpl3 G A 5: 22,775,987 probably benign Het
Map4k3 A G 17: 80,644,323 probably benign Het
Mas1 C G 17: 12,841,993 S181T probably benign Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Nubpl T C 12: 52,144,027 M65T probably damaging Het
Olfr813 A C 10: 129,857,147 M210L probably benign Het
Parp14 A G 16: 35,853,748 I1042T possibly damaging Het
Pcdh15 C A 10: 74,631,686 S1779Y probably damaging Het
Pgm5 C T 19: 24,820,203 R205Q probably damaging Het
Radil T C 5: 142,506,997 D292G probably damaging Het
Rbp3 C A 14: 33,955,507 H471N probably damaging Het
Rgs14 T A 13: 55,379,614 L221Q possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco4a1 C T 2: 180,464,091 T22M probably benign Het
Sult2b1 G T 7: 45,730,037 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Ttn G T 2: 76,751,334 L23072I possibly damaging Het
Zfp521 T C 18: 13,717,751 probably benign Het
Other mutations in Itpkc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01751:Itpkc APN 7 27213066 unclassified probably benign
IGL01774:Itpkc APN 7 27212370 missense probably benign 0.05
IGL02134:Itpkc APN 7 27227875 nonsense probably null
IGL02719:Itpkc APN 7 27228050 missense possibly damaging 0.92
R0284:Itpkc UTSW 7 27214543 nonsense probably null
R0364:Itpkc UTSW 7 27227749 missense possibly damaging 0.80
R0403:Itpkc UTSW 7 27208345 missense probably benign 0.01
R1175:Itpkc UTSW 7 27227770 missense probably benign 0.00
R1676:Itpkc UTSW 7 27208281 missense probably damaging 1.00
R1813:Itpkc UTSW 7 27208380 missense probably damaging 1.00
R1896:Itpkc UTSW 7 27208380 missense probably damaging 1.00
R1944:Itpkc UTSW 7 27227659 missense possibly damaging 0.55
R2142:Itpkc UTSW 7 27219650 missense possibly damaging 0.83
R3030:Itpkc UTSW 7 27212308 splice site probably null
R3738:Itpkc UTSW 7 27227604 missense possibly damaging 0.95
R3739:Itpkc UTSW 7 27227604 missense possibly damaging 0.95
R3754:Itpkc UTSW 7 27228432 missense probably damaging 1.00
R3852:Itpkc UTSW 7 27227612 missense probably benign 0.00
R3916:Itpkc UTSW 7 27228303 missense probably benign 0.09
R3963:Itpkc UTSW 7 27227509 missense probably damaging 1.00
R5770:Itpkc UTSW 7 27212988 missense probably damaging 1.00
R5943:Itpkc UTSW 7 27212979 missense possibly damaging 0.69
R6012:Itpkc UTSW 7 27228065 missense probably damaging 0.98
R6835:Itpkc UTSW 7 27227815 missense probably benign 0.02
R7107:Itpkc UTSW 7 27228277 missense probably benign 0.15
R7379:Itpkc UTSW 7 27227769 missense probably benign 0.12
R8305:Itpkc UTSW 7 27214519 missense probably damaging 1.00
R8365:Itpkc UTSW 7 27212352 missense probably damaging 1.00
R9216:Itpkc UTSW 7 27228004 missense probably benign 0.19
R9634:Itpkc UTSW 7 27214455 missense probably benign 0.29
R9764:Itpkc UTSW 7 27227797 missense probably benign 0.00
Z1176:Itpkc UTSW 7 27227638 missense probably benign 0.01
Z1177:Itpkc UTSW 7 27227781 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTCAGATTCATCAAAAGAGGAGGC -3'
(R):5'- GAATTGTCCGCGGATGCTTC -3'

Sequencing Primer
(F):5'- AAGAGAAGCCGCCAGTGCC -3'
(R):5'- GATGCTTCCAGGACTCCACATG -3'
Posted On 2015-04-06