Incidental Mutation 'R3851:Tmem59l'
ID275925
Institutional Source Beutler Lab
Gene Symbol Tmem59l
Ensembl Gene ENSMUSG00000035964
Gene Nametransmembrane protein 59-like
Synonyms
MMRRC Submission 040899-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3851 (G1)
Quality Score91
Status Validated
Chromosome8
Chromosomal Location70483867-70487358 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70487301 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 6 (L6S)
Ref Sequence ENSEMBL: ENSMUSP00000043659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045286]
Predicted Effect unknown
Transcript: ENSMUST00000045286
AA Change: L6S
SMART Domains Protein: ENSMUSP00000043659
Gene: ENSMUSG00000035964
AA Change: L6S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 33 41 N/A INTRINSIC
low complexity region 44 60 N/A INTRINSIC
Pfam:BSMAP 72 278 1e-67 PFAM
low complexity region 311 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211264
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted type-I membrane glycoprotein. The encoded protein may play a role in functioning of the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 G A 7: 101,390,165 W544* probably null Het
AY358078 A G 14: 51,805,553 T233A unknown Het
Bcl9 G A 3: 97,209,653 P575L probably damaging Het
Calcr T C 6: 3,693,735 Y353C probably damaging Het
Cry1 C A 10: 85,146,499 A328S probably benign Het
Dclre1a A T 19: 56,541,507 N799K probably damaging Het
Dnm3 A T 1: 162,321,127 probably null Het
Dock9 A T 14: 121,629,086 probably null Het
Dpysl4 C T 7: 139,100,935 T575M probably damaging Het
Drc7 C T 8: 95,061,836 Q276* probably null Het
Dzip3 T C 16: 48,950,013 T389A possibly damaging Het
Fam196a A G 7: 134,884,526 V432A probably benign Het
Flnc T A 6: 29,453,719 L1801Q probably damaging Het
Fmo9 A G 1: 166,663,367 L463P probably benign Het
Fnip2 G C 3: 79,462,157 H1074D probably damaging Het
Golga2 A G 2: 32,305,611 E806G probably benign Het
H2-Q5 T A 17: 35,394,139 M5K unknown Het
Il27ra C T 8: 84,040,688 E169K probably benign Het
Itpkc A T 7: 27,227,612 N292K probably benign Het
Lhfpl3 G A 5: 22,775,987 probably benign Het
Map4k3 A G 17: 80,644,323 probably benign Het
Mas1 C G 17: 12,841,993 S181T probably benign Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Nubpl T C 12: 52,144,027 M65T probably damaging Het
Olfr813 A C 10: 129,857,147 M210L probably benign Het
Parp14 A G 16: 35,853,748 I1042T possibly damaging Het
Pcdh15 C A 10: 74,631,686 S1779Y probably damaging Het
Pgm5 C T 19: 24,820,203 R205Q probably damaging Het
Radil T C 5: 142,506,997 D292G probably damaging Het
Rbp3 C A 14: 33,955,507 H471N probably damaging Het
Rgs14 T A 13: 55,379,614 L221Q possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco4a1 C T 2: 180,464,091 T22M probably benign Het
Sult2b1 G T 7: 45,730,037 probably benign Het
Ttn G T 2: 76,751,334 L23072I possibly damaging Het
Zfp521 T C 18: 13,717,751 probably benign Het
Other mutations in Tmem59l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Tmem59l APN 8 70485665 splice site probably benign
IGL01479:Tmem59l APN 8 70486098 missense probably benign 0.00
IGL01783:Tmem59l APN 8 70487224 missense probably damaging 1.00
IGL01998:Tmem59l APN 8 70484781 missense probably benign 0.16
R0973:Tmem59l UTSW 8 70486060 missense possibly damaging 0.93
R0973:Tmem59l UTSW 8 70486060 missense possibly damaging 0.93
R0974:Tmem59l UTSW 8 70486060 missense possibly damaging 0.93
R1201:Tmem59l UTSW 8 70484387 nonsense probably null
R1540:Tmem59l UTSW 8 70485154 missense probably benign 0.05
R1775:Tmem59l UTSW 8 70486253 missense probably damaging 1.00
R2217:Tmem59l UTSW 8 70487301 missense unknown
R2238:Tmem59l UTSW 8 70485122 missense probably damaging 0.99
R2313:Tmem59l UTSW 8 70487301 missense unknown
R2315:Tmem59l UTSW 8 70487301 missense unknown
R2969:Tmem59l UTSW 8 70487301 missense unknown
R2970:Tmem59l UTSW 8 70487301 missense unknown
R3011:Tmem59l UTSW 8 70486237 missense probably damaging 1.00
R3725:Tmem59l UTSW 8 70487301 missense unknown
R3726:Tmem59l UTSW 8 70487301 missense unknown
R3774:Tmem59l UTSW 8 70487301 missense unknown
R3775:Tmem59l UTSW 8 70487301 missense unknown
R3826:Tmem59l UTSW 8 70487301 missense unknown
R3827:Tmem59l UTSW 8 70487301 missense unknown
R3828:Tmem59l UTSW 8 70487301 missense unknown
R3829:Tmem59l UTSW 8 70487301 missense unknown
R3943:Tmem59l UTSW 8 70487301 missense unknown
R3944:Tmem59l UTSW 8 70487301 missense unknown
R4064:Tmem59l UTSW 8 70485719 missense probably damaging 1.00
R4409:Tmem59l UTSW 8 70487301 missense unknown
R4410:Tmem59l UTSW 8 70487301 missense unknown
R4422:Tmem59l UTSW 8 70486099 missense probably damaging 0.98
R4470:Tmem59l UTSW 8 70487301 missense unknown
R4471:Tmem59l UTSW 8 70487301 missense unknown
R4767:Tmem59l UTSW 8 70486098 missense probably benign 0.00
R5321:Tmem59l UTSW 8 70487215 missense probably damaging 1.00
R6130:Tmem59l UTSW 8 70484605 missense probably damaging 1.00
R6527:Tmem59l UTSW 8 70486125 missense probably damaging 1.00
R6603:Tmem59l UTSW 8 70486356 missense probably benign 0.31
R6750:Tmem59l UTSW 8 70486372 missense probably benign 0.34
R7542:Tmem59l UTSW 8 70485164 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TCCATCTGAGGGTCCTACAC -3'
(R):5'- ATCCAAGTCCGGTCAAAGAG -3'

Sequencing Primer
(F):5'- AGGGTCCTACACTCAGGTC -3'
(R):5'- TCAGTGACGTCAACACC -3'
Posted On2015-04-06