Incidental Mutation 'R3851:Olfr813'
ID275930
Institutional Source Beutler Lab
Gene Symbol Olfr813
Ensembl Gene ENSMUSG00000052818
Gene Nameolfactory receptor 813
SynonymsMOR108-3, GA_x6K02T2PULF-11535078-11536010
MMRRC Submission 040899-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R3851 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129855367-129858722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 129857147 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 210 (M210L)
Ref Sequence ENSEMBL: ENSMUSP00000145260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064893] [ENSMUST00000204622]
Predicted Effect probably benign
Transcript: ENSMUST00000064893
AA Change: M210L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000063431
Gene: ENSMUSG00000052818
AA Change: M210L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.2e-49 PFAM
Pfam:7tm_1 39 288 3.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204622
AA Change: M210L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000145260
Gene: ENSMUSG00000052818
AA Change: M210L

DomainStartEndE-ValueType
Pfam:7tm_4 44 321 3.5e-49 PFAM
Pfam:7tm_1 54 303 1.3e-21 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 G A 7: 101,390,165 W544* probably null Het
AY358078 A G 14: 51,805,553 T233A unknown Het
Bcl9 G A 3: 97,209,653 P575L probably damaging Het
Calcr T C 6: 3,693,735 Y353C probably damaging Het
Cry1 C A 10: 85,146,499 A328S probably benign Het
Dclre1a A T 19: 56,541,507 N799K probably damaging Het
Dnm3 A T 1: 162,321,127 probably null Het
Dock9 A T 14: 121,629,086 probably null Het
Dpysl4 C T 7: 139,100,935 T575M probably damaging Het
Drc7 C T 8: 95,061,836 Q276* probably null Het
Dzip3 T C 16: 48,950,013 T389A possibly damaging Het
Fam196a A G 7: 134,884,526 V432A probably benign Het
Flnc T A 6: 29,453,719 L1801Q probably damaging Het
Fmo9 A G 1: 166,663,367 L463P probably benign Het
Fnip2 G C 3: 79,462,157 H1074D probably damaging Het
Golga2 A G 2: 32,305,611 E806G probably benign Het
H2-Q5 T A 17: 35,394,139 M5K unknown Het
Il27ra C T 8: 84,040,688 E169K probably benign Het
Itpkc A T 7: 27,227,612 N292K probably benign Het
Lhfpl3 G A 5: 22,775,987 probably benign Het
Map4k3 A G 17: 80,644,323 probably benign Het
Mas1 C G 17: 12,841,993 S181T probably benign Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Nubpl T C 12: 52,144,027 M65T probably damaging Het
Parp14 A G 16: 35,853,748 I1042T possibly damaging Het
Pcdh15 C A 10: 74,631,686 S1779Y probably damaging Het
Pgm5 C T 19: 24,820,203 R205Q probably damaging Het
Radil T C 5: 142,506,997 D292G probably damaging Het
Rbp3 C A 14: 33,955,507 H471N probably damaging Het
Rgs14 T A 13: 55,379,614 L221Q possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco4a1 C T 2: 180,464,091 T22M probably benign Het
Sult2b1 G T 7: 45,730,037 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Ttn G T 2: 76,751,334 L23072I possibly damaging Het
Zfp521 T C 18: 13,717,751 probably benign Het
Other mutations in Olfr813
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Olfr813 APN 10 129856628 missense probably benign 0.00
IGL01650:Olfr813 APN 10 129857067 missense probably damaging 1.00
IGL01734:Olfr813 APN 10 129856802 missense probably benign 0.36
IGL01909:Olfr813 APN 10 129857081 missense probably damaging 0.99
R0256:Olfr813 UTSW 10 129857037 missense probably damaging 1.00
R0607:Olfr813 UTSW 10 129857201 missense possibly damaging 0.67
R0924:Olfr813 UTSW 10 129856646 missense probably damaging 1.00
R1345:Olfr813 UTSW 10 129856890 missense probably damaging 1.00
R1462:Olfr813 UTSW 10 129857231 missense probably damaging 0.98
R1462:Olfr813 UTSW 10 129857231 missense probably damaging 0.98
R2344:Olfr813 UTSW 10 129856541 missense probably benign 0.01
R4486:Olfr813 UTSW 10 129856698 missense probably damaging 1.00
R4934:Olfr813 UTSW 10 129857027 missense possibly damaging 0.91
R5397:Olfr813 UTSW 10 129856710 missense probably damaging 1.00
R5644:Olfr813 UTSW 10 129857427 missense probably benign 0.38
R5925:Olfr813 UTSW 10 129856875 missense probably damaging 1.00
R6224:Olfr813 UTSW 10 129857192 missense probably benign 0.17
R7839:Olfr813 UTSW 10 129857030 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AGATCTGCCACCAGCTCATC -3'
(R):5'- TTTGTTAAAGCAACTCCAGCC -3'

Sequencing Primer
(F):5'- AGCTCATCATCAGCTCCTGG -3'
(R):5'- AACTCCAGCCTTGGCAGATG -3'
Posted On2015-04-06