Incidental Mutation 'R3851:Ntn1'
ID275931
Institutional Source Beutler Lab
Gene Symbol Ntn1
Ensembl Gene ENSMUSG00000020902
Gene Namenetrin 1
SynonymsNetrin-1
MMRRC Submission 040899-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.328) question?
Stock #R3851 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location68209364-68400823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 68385793 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Histidine at position 110 (D110H)
Ref Sequence ENSEMBL: ENSMUSP00000121193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021284] [ENSMUST00000108674] [ENSMUST00000135141]
Predicted Effect probably damaging
Transcript: ENSMUST00000021284
AA Change: D110H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021284
Gene: ENSMUSG00000020902
AA Change: D110H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108674
AA Change: D110H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104314
Gene: ENSMUSG00000020902
AA Change: D110H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135141
AA Change: D110H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121193
Gene: ENSMUSG00000020902
AA Change: D110H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 159 6.8e-15 SMART
Meta Mutation Damage Score 0.9089 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Netrin is included in a family of laminin-related secreted proteins. The function of this gene has not yet been defined; however, netrin is thought to be involved in axon guidance and cell migration during development. Mutations and loss of expression of netrin suggest that variation in netrin may be involved in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit impaired axonal migration, abnormal semicircular canals, lack of corpus callosum, aberrant commissures, hypoplasia of the optic nerve, motor and balance defects, failure to suckle, and neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 G A 7: 101,390,165 W544* probably null Het
AY358078 A G 14: 51,805,553 T233A unknown Het
Bcl9 G A 3: 97,209,653 P575L probably damaging Het
Calcr T C 6: 3,693,735 Y353C probably damaging Het
Cry1 C A 10: 85,146,499 A328S probably benign Het
Dclre1a A T 19: 56,541,507 N799K probably damaging Het
Dnm3 A T 1: 162,321,127 probably null Het
Dock9 A T 14: 121,629,086 probably null Het
Dpysl4 C T 7: 139,100,935 T575M probably damaging Het
Drc7 C T 8: 95,061,836 Q276* probably null Het
Dzip3 T C 16: 48,950,013 T389A possibly damaging Het
Fam196a A G 7: 134,884,526 V432A probably benign Het
Flnc T A 6: 29,453,719 L1801Q probably damaging Het
Fmo9 A G 1: 166,663,367 L463P probably benign Het
Fnip2 G C 3: 79,462,157 H1074D probably damaging Het
Golga2 A G 2: 32,305,611 E806G probably benign Het
H2-Q5 T A 17: 35,394,139 M5K unknown Het
Il27ra C T 8: 84,040,688 E169K probably benign Het
Itpkc A T 7: 27,227,612 N292K probably benign Het
Lhfpl3 G A 5: 22,775,987 probably benign Het
Map4k3 A G 17: 80,644,323 probably benign Het
Mas1 C G 17: 12,841,993 S181T probably benign Het
Nubpl T C 12: 52,144,027 M65T probably damaging Het
Olfr813 A C 10: 129,857,147 M210L probably benign Het
Parp14 A G 16: 35,853,748 I1042T possibly damaging Het
Pcdh15 C A 10: 74,631,686 S1779Y probably damaging Het
Pgm5 C T 19: 24,820,203 R205Q probably damaging Het
Radil T C 5: 142,506,997 D292G probably damaging Het
Rbp3 C A 14: 33,955,507 H471N probably damaging Het
Rgs14 T A 13: 55,379,614 L221Q possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco4a1 C T 2: 180,464,091 T22M probably benign Het
Sult2b1 G T 7: 45,730,037 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Ttn G T 2: 76,751,334 L23072I possibly damaging Het
Zfp521 T C 18: 13,717,751 probably benign Het
Other mutations in Ntn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ntn1 APN 11 68226619 splice site probably benign
IGL00972:Ntn1 APN 11 68213272 missense possibly damaging 0.83
IGL01695:Ntn1 APN 11 68226604 missense probably benign 0.00
IGL01731:Ntn1 APN 11 68385418 missense probably damaging 1.00
IGL02008:Ntn1 APN 11 68213263 missense probably damaging 1.00
IGL02584:Ntn1 APN 11 68277530 missense probably damaging 1.00
IGL02664:Ntn1 APN 11 68385469 missense probably benign 0.06
R0363:Ntn1 UTSW 11 68385543 missense probably benign 0.44
R1201:Ntn1 UTSW 11 68213226 missense probably damaging 0.96
R1268:Ntn1 UTSW 11 68213133 small deletion probably benign
R1913:Ntn1 UTSW 11 68213185 missense probably damaging 1.00
R2245:Ntn1 UTSW 11 68385294 missense probably benign 0.12
R2248:Ntn1 UTSW 11 68277572 missense possibly damaging 0.95
R2359:Ntn1 UTSW 11 68385612 missense probably damaging 1.00
R2862:Ntn1 UTSW 11 68385864 missense probably benign 0.00
R3830:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R3852:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R4413:Ntn1 UTSW 11 68385910 missense probably damaging 1.00
R4870:Ntn1 UTSW 11 68213026 small deletion probably benign
R4871:Ntn1 UTSW 11 68213026 small deletion probably benign
R4952:Ntn1 UTSW 11 68213026 small deletion probably benign
R5001:Ntn1 UTSW 11 68260532 missense probably damaging 1.00
R5279:Ntn1 UTSW 11 68385712 missense probably benign 0.37
R6217:Ntn1 UTSW 11 68213332 missense possibly damaging 0.91
R6505:Ntn1 UTSW 11 68213199 missense probably damaging 1.00
R6669:Ntn1 UTSW 11 68385750 missense probably benign 0.00
R7172:Ntn1 UTSW 11 68385667 missense probably damaging 1.00
R7411:Ntn1 UTSW 11 68386089 missense probably benign 0.15
R8314:Ntn1 UTSW 11 68385624 missense probably damaging 1.00
X0027:Ntn1 UTSW 11 68385636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGGTTGTACATTTTGCGGC -3'
(R):5'- ACTTTGTCAACGCGGCCTTC -3'

Sequencing Primer
(F):5'- ACATTTTGCGGCACTGCG -3'
(R):5'- TTCGGCAAGGACGTGCG -3'
Posted On2015-04-06