Incidental Mutation 'R3851:Rgs14'
ID275935
Institutional Source Beutler Lab
Gene Symbol Rgs14
Ensembl Gene ENSMUSG00000052087
Gene Nameregulator of G-protein signaling 14
SynonymsRap1/rap2 interacting protein
MMRRC Submission 040899-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R3851 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55369732-55384687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55379614 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 221 (L221Q)
Ref Sequence ENSEMBL: ENSMUSP00000068731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063771] [ENSMUST00000149858]
PDB Structure
Solution structure of the Ras-binding domain of mouse RGS14 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063771
AA Change: L221Q

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000068731
Gene: ENSMUSG00000052087
AA Change: L221Q

DomainStartEndE-ValueType
RGS 67 184 3.42e-44 SMART
low complexity region 209 222 N/A INTRINSIC
low complexity region 289 299 N/A INTRINSIC
RBD 303 374 2e-26 SMART
RBD 376 446 4.53e-16 SMART
low complexity region 474 491 N/A INTRINSIC
GoLoco 500 522 1.74e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135851
Predicted Effect probably benign
Transcript: ENSMUST00000149858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224185
Meta Mutation Damage Score 0.0863 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulator of G-protein signaling family. This protein contains one RGS domain, two Raf-like Ras-binding domains (RBDs), and one GoLoco domain. The protein attenuates the signaling activity of G-proteins by binding, through its GoLoco domain, to specific types of activated, GTP-bound G alpha subunits. Acting as a GTPase activating protein (GAP), the protein increases the rate of conversion of the GTP to GDP. This hydrolysis allows the G alpha subunits to bind G beta/gamma subunit heterodimers, forming inactive G-protein heterotrimers, thereby terminating the signal. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene with one allele results in failure to complete the first zygotic cell division. Homozygous mutation of this gene with a second allele results in no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 G A 7: 101,390,165 W544* probably null Het
AY358078 A G 14: 51,805,553 T233A unknown Het
Bcl9 G A 3: 97,209,653 P575L probably damaging Het
Calcr T C 6: 3,693,735 Y353C probably damaging Het
Cry1 C A 10: 85,146,499 A328S probably benign Het
Dclre1a A T 19: 56,541,507 N799K probably damaging Het
Dnm3 A T 1: 162,321,127 probably null Het
Dock9 A T 14: 121,629,086 probably null Het
Dpysl4 C T 7: 139,100,935 T575M probably damaging Het
Drc7 C T 8: 95,061,836 Q276* probably null Het
Dzip3 T C 16: 48,950,013 T389A possibly damaging Het
Fam196a A G 7: 134,884,526 V432A probably benign Het
Flnc T A 6: 29,453,719 L1801Q probably damaging Het
Fmo9 A G 1: 166,663,367 L463P probably benign Het
Fnip2 G C 3: 79,462,157 H1074D probably damaging Het
Golga2 A G 2: 32,305,611 E806G probably benign Het
H2-Q5 T A 17: 35,394,139 M5K unknown Het
Il27ra C T 8: 84,040,688 E169K probably benign Het
Itpkc A T 7: 27,227,612 N292K probably benign Het
Lhfpl3 G A 5: 22,775,987 probably benign Het
Map4k3 A G 17: 80,644,323 probably benign Het
Mas1 C G 17: 12,841,993 S181T probably benign Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Nubpl T C 12: 52,144,027 M65T probably damaging Het
Olfr813 A C 10: 129,857,147 M210L probably benign Het
Parp14 A G 16: 35,853,748 I1042T possibly damaging Het
Pcdh15 C A 10: 74,631,686 S1779Y probably damaging Het
Pgm5 C T 19: 24,820,203 R205Q probably damaging Het
Radil T C 5: 142,506,997 D292G probably damaging Het
Rbp3 C A 14: 33,955,507 H471N probably damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco4a1 C T 2: 180,464,091 T22M probably benign Het
Sult2b1 G T 7: 45,730,037 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Ttn G T 2: 76,751,334 L23072I possibly damaging Het
Zfp521 T C 18: 13,717,751 probably benign Het
Other mutations in Rgs14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01820:Rgs14 APN 13 55383525 missense probably benign 0.04
IGL02691:Rgs14 APN 13 55379023 splice site probably null
R1655:Rgs14 UTSW 13 55383534 missense probably benign 0.00
R1716:Rgs14 UTSW 13 55378883 missense probably damaging 0.99
R1839:Rgs14 UTSW 13 55382838 unclassified probably benign
R2014:Rgs14 UTSW 13 55383700 nonsense probably null
R4008:Rgs14 UTSW 13 55369913 missense probably damaging 0.99
R4299:Rgs14 UTSW 13 55383753 missense probably damaging 1.00
R4572:Rgs14 UTSW 13 55380062 missense probably damaging 0.96
R4801:Rgs14 UTSW 13 55380957 missense probably damaging 1.00
R4802:Rgs14 UTSW 13 55380957 missense probably damaging 1.00
R7136:Rgs14 UTSW 13 55379695 splice site probably null
R7142:Rgs14 UTSW 13 55379604 missense probably damaging 0.99
R7207:Rgs14 UTSW 13 55383234 missense probably benign 0.00
R7701:Rgs14 UTSW 13 55379325 missense probably damaging 1.00
R8021:Rgs14 UTSW 13 55383756 missense probably damaging 0.97
R8405:Rgs14 UTSW 13 55383149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACCAAGAGTGCCTGCTG -3'
(R):5'- CTTATTGCAGACTGGGTCAGATAG -3'

Sequencing Primer
(F):5'- GGAACCTGGCTCCTCACAC -3'
(R):5'- TAGGAAGAAAAGGGCGGTCC -3'
Posted On2015-04-06