Incidental Mutation 'R3852:Mstn'
ID275945
Institutional Source Beutler Lab
Gene Symbol Mstn
Ensembl Gene ENSMUSG00000026100
Gene Namemyostatin
SynonymsGdf8
MMRRC Submission 040784-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R3852 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location53061640-53068079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 53061971 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 69 (T69I)
Ref Sequence ENSEMBL: ENSMUSP00000140249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027269] [ENSMUST00000191197]
Predicted Effect probably benign
Transcript: ENSMUST00000027269
AA Change: T69I

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027269
Gene: ENSMUSG00000026100
AA Change: T69I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:TGFb_propeptide 38 266 1.3e-30 PFAM
TGFB 282 376 2.31e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000191197
AA Change: T69I

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140249
Gene: ENSMUSG00000026100
AA Change: T69I

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 13 188 1.3e-29 PFAM
Meta Mutation Damage Score 0.0772 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein negatively regulates skeletal muscle cell proliferation and differentiation. Homozygous knockout mice for this gene exhibit increased muscle mass and bone density, and reduced adiposity. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit markedly increased size of striated muscle due to both hyperplasia and hypertrophy, reduced adiposity, and increased bone mineral density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T C 16: 20,560,439 V685A probably damaging Het
Abhd4 T C 14: 54,265,367 Y44H probably damaging Het
AI429214 A G 8: 36,994,442 D248G probably damaging Het
AY358078 A G 14: 51,805,553 T233A unknown Het
Calcr T C 6: 3,693,735 Y353C probably damaging Het
Ccdc34 A G 2: 110,032,428 K193E possibly damaging Het
Dhcr24 A G 4: 106,573,873 E253G probably benign Het
Dnah6 A G 6: 73,127,927 V1841A possibly damaging Het
Dpp10 A T 1: 123,485,924 Y186* probably null Het
Dpysl4 C T 7: 139,100,935 T575M probably damaging Het
Dusp7 T A 9: 106,373,893 S406T probably benign Het
Gga3 T A 11: 115,587,542 T475S probably benign Het
Gm10271 T A 10: 116,956,874 K36* probably null Het
Gm572 G A 4: 148,668,872 E325K possibly damaging Het
Golga2 A G 2: 32,305,611 E806G probably benign Het
Igf1 A T 10: 87,915,319 K126* probably null Het
Itpkc A T 7: 27,227,612 N292K probably benign Het
Klhl1 A T 14: 96,280,205 M345K probably benign Het
Lrp2 A G 2: 69,537,565 V201A probably damaging Het
Lrrc8a C T 2: 30,261,960 T757M probably benign Het
Mios T A 6: 8,216,453 I459K probably benign Het
Mrps11 T C 7: 78,790,645 I94T probably damaging Het
Ms4a4c T A 19: 11,416,395 S68T probably benign Het
Myo10 A G 15: 25,779,626 K28E probably damaging Het
Nol6 A G 4: 41,117,452 S914P probably damaging Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr547 C A 7: 102,535,280 H178N probably benign Het
Olfr585 T C 7: 103,098,184 S148P probably damaging Het
Pcdh17 C T 14: 84,447,259 Q389* probably null Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Prr14l T C 5: 32,830,345 E602G probably damaging Het
Rusc2 C A 4: 43,416,424 Q577K probably benign Het
Sacm1l T A 9: 123,587,576 M534K probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco4a1 C T 2: 180,464,091 T22M probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tas2r104 A T 6: 131,684,925 C274S probably benign Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trim43c T A 9: 88,840,401 H33Q probably damaging Het
Ttc17 A T 2: 94,369,413 I411K possibly damaging Het
Ttn G T 2: 76,751,334 L23072I possibly damaging Het
Ttn A C 2: 76,955,024 V669G possibly damaging Het
Vmn1r60 A T 7: 5,545,027 F25I possibly damaging Het
Vmn2r9 A G 5: 108,848,131 I217T probably damaging Het
Other mutations in Mstn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Mstn APN 1 53061997 missense possibly damaging 0.47
IGL01432:Mstn APN 1 53066530 missense possibly damaging 0.65
IGL02009:Mstn APN 1 53062150 splice site probably benign
IGL02547:Mstn APN 1 53064125 missense probably benign 0.08
PIT4403001:Mstn UTSW 1 53061785 missense probably benign 0.00
R0499:Mstn UTSW 1 53063984 missense probably damaging 1.00
R0556:Mstn UTSW 1 53064125 missense probably benign 0.08
R0730:Mstn UTSW 1 53061794 missense possibly damaging 0.81
R1180:Mstn UTSW 1 53064008 missense possibly damaging 0.93
R1472:Mstn UTSW 1 53061998 missense probably damaging 0.99
R1659:Mstn UTSW 1 53064077 nonsense probably null
R1676:Mstn UTSW 1 53062065 missense probably benign 0.08
R1753:Mstn UTSW 1 53066558 missense probably damaging 1.00
R4773:Mstn UTSW 1 53062108 missense probably benign 0.18
R4938:Mstn UTSW 1 53066423 missense possibly damaging 0.90
R6000:Mstn UTSW 1 53061669 start gained probably benign
R6393:Mstn UTSW 1 53066489 missense probably benign 0.00
R6991:Mstn UTSW 1 53061941 missense probably benign 0.02
R7018:Mstn UTSW 1 53064084 missense possibly damaging 0.51
R7077:Mstn UTSW 1 53064249 missense probably benign 0.30
R7170:Mstn UTSW 1 53066395 missense probably damaging 1.00
R7300:Mstn UTSW 1 53064080 missense probably benign 0.13
R7486:Mstn UTSW 1 53063969 missense probably damaging 1.00
R8063:Mstn UTSW 1 53066448 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CTGTTCATGCTGATTGCTGC -3'
(R):5'- TCTCATAAACACTAGGACAGCAGTC -3'

Sequencing Primer
(F):5'- CTGGCCCAGTGGATCTAAATG -3'
(R):5'- GATATACTTACACTCTGTAGGCATGG -3'
Posted On2015-04-06