Incidental Mutation 'R3852:Mstn'
ID 275945
Institutional Source Beutler Lab
Gene Symbol Mstn
Ensembl Gene ENSMUSG00000026100
Gene Name myostatin
Synonyms Gdf8
MMRRC Submission 040784-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.864) question?
Stock # R3852 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 53100799-53107238 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 53101130 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 69 (T69I)
Ref Sequence ENSEMBL: ENSMUSP00000140249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027269] [ENSMUST00000191197]
AlphaFold O08689
Predicted Effect probably benign
Transcript: ENSMUST00000027269
AA Change: T69I

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027269
Gene: ENSMUSG00000026100
AA Change: T69I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:TGFb_propeptide 38 266 1.3e-30 PFAM
TGFB 282 376 2.31e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000191197
AA Change: T69I

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140249
Gene: ENSMUSG00000026100
AA Change: T69I

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 13 188 1.3e-29 PFAM
Meta Mutation Damage Score 0.0772 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein negatively regulates skeletal muscle cell proliferation and differentiation. Homozygous knockout mice for this gene exhibit increased muscle mass and bone density, and reduced adiposity. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit markedly increased size of striated muscle due to both hyperplasia and hypertrophy, reduced adiposity, and increased bone mineral density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T C 16: 20,379,189 (GRCm39) V685A probably damaging Het
Abhd4 T C 14: 54,502,824 (GRCm39) Y44H probably damaging Het
AI429214 A G 8: 37,461,596 (GRCm39) D248G probably damaging Het
Aoc1l3 C T 6: 48,964,928 (GRCm39) P312L possibly damaging Het
AY358078 A G 14: 52,043,010 (GRCm39) T233A unknown Het
Calcr T C 6: 3,693,735 (GRCm39) Y353C probably damaging Het
Ccdc34 A G 2: 109,862,773 (GRCm39) K193E possibly damaging Het
Dhcr24 A G 4: 106,431,070 (GRCm39) E253G probably benign Het
Dnah6 A G 6: 73,104,910 (GRCm39) V1841A possibly damaging Het
Dpp10 A T 1: 123,413,653 (GRCm39) Y186* probably null Het
Dpysl4 C T 7: 138,680,851 (GRCm39) T575M probably damaging Het
Dusp7 T A 9: 106,251,092 (GRCm39) S406T probably benign Het
Gga3 T A 11: 115,478,368 (GRCm39) T475S probably benign Het
Gm10271 T A 10: 116,792,779 (GRCm39) K36* probably null Het
Gm572 G A 4: 148,753,329 (GRCm39) E325K possibly damaging Het
Golga2 A G 2: 32,195,623 (GRCm39) E806G probably benign Het
Igf1 A T 10: 87,751,181 (GRCm39) K126* probably null Het
Itpkc A T 7: 26,927,037 (GRCm39) N292K probably benign Het
Klhl1 A T 14: 96,517,641 (GRCm39) M345K probably benign Het
Lrp2 A G 2: 69,367,909 (GRCm39) V201A probably damaging Het
Lrrc8a C T 2: 30,151,972 (GRCm39) T757M probably benign Het
Mios T A 6: 8,216,453 (GRCm39) I459K probably benign Het
Mrps11 T C 7: 78,440,393 (GRCm39) I94T probably damaging Het
Ms4a4c T A 19: 11,393,759 (GRCm39) S68T probably benign Het
Myo10 A G 15: 25,779,712 (GRCm39) K28E probably damaging Het
Nol6 A G 4: 41,117,452 (GRCm39) S914P probably damaging Het
Ntn1 C G 11: 68,276,619 (GRCm39) D110H probably damaging Het
Or51f1e T C 7: 102,747,391 (GRCm39) S148P probably damaging Het
Or52b4 C A 7: 102,184,487 (GRCm39) H178N probably benign Het
Pcdh17 C T 14: 84,684,699 (GRCm39) Q389* probably null Het
Pik3r2 G A 8: 71,223,065 (GRCm39) R452C probably benign Het
Prr14l T C 5: 32,987,689 (GRCm39) E602G probably damaging Het
Rusc2 C A 4: 43,416,424 (GRCm39) Q577K probably benign Het
Sacm1l T A 9: 123,416,641 (GRCm39) M534K probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slco4a1 C T 2: 180,105,884 (GRCm39) T22M probably benign Het
Tas2r104 A T 6: 131,661,888 (GRCm39) C274S probably benign Het
Tnrc6c C T 11: 117,614,355 (GRCm39) R838W probably damaging Het
Trim43c T A 9: 88,722,454 (GRCm39) H33Q probably damaging Het
Ttc17 A T 2: 94,199,758 (GRCm39) I411K possibly damaging Het
Ttn G T 2: 76,581,678 (GRCm39) L23072I possibly damaging Het
Ttn A C 2: 76,785,368 (GRCm39) V669G possibly damaging Het
Vmn1r60 A T 7: 5,548,026 (GRCm39) F25I possibly damaging Het
Vmn2r9 A G 5: 108,995,997 (GRCm39) I217T probably damaging Het
Other mutations in Mstn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Mstn APN 1 53,101,156 (GRCm39) missense possibly damaging 0.47
IGL01432:Mstn APN 1 53,105,689 (GRCm39) missense possibly damaging 0.65
IGL02009:Mstn APN 1 53,101,309 (GRCm39) splice site probably benign
IGL02547:Mstn APN 1 53,103,284 (GRCm39) missense probably benign 0.08
PIT4403001:Mstn UTSW 1 53,100,944 (GRCm39) missense probably benign 0.00
R0499:Mstn UTSW 1 53,103,143 (GRCm39) missense probably damaging 1.00
R0556:Mstn UTSW 1 53,103,284 (GRCm39) missense probably benign 0.08
R0730:Mstn UTSW 1 53,100,953 (GRCm39) missense possibly damaging 0.81
R1180:Mstn UTSW 1 53,103,167 (GRCm39) missense possibly damaging 0.93
R1472:Mstn UTSW 1 53,101,157 (GRCm39) missense probably damaging 0.99
R1659:Mstn UTSW 1 53,103,236 (GRCm39) nonsense probably null
R1676:Mstn UTSW 1 53,101,224 (GRCm39) missense probably benign 0.08
R1753:Mstn UTSW 1 53,105,717 (GRCm39) missense probably damaging 1.00
R4773:Mstn UTSW 1 53,101,267 (GRCm39) missense probably benign 0.18
R4938:Mstn UTSW 1 53,105,582 (GRCm39) missense possibly damaging 0.90
R6000:Mstn UTSW 1 53,100,828 (GRCm39) start gained probably benign
R6393:Mstn UTSW 1 53,105,648 (GRCm39) missense probably benign 0.00
R6991:Mstn UTSW 1 53,101,100 (GRCm39) missense probably benign 0.02
R7018:Mstn UTSW 1 53,103,243 (GRCm39) missense possibly damaging 0.51
R7077:Mstn UTSW 1 53,103,408 (GRCm39) missense probably benign 0.30
R7170:Mstn UTSW 1 53,105,554 (GRCm39) missense probably damaging 1.00
R7300:Mstn UTSW 1 53,103,239 (GRCm39) missense probably benign 0.13
R7486:Mstn UTSW 1 53,103,128 (GRCm39) missense probably damaging 1.00
R8063:Mstn UTSW 1 53,105,607 (GRCm39) missense probably benign 0.10
R8966:Mstn UTSW 1 53,105,641 (GRCm39) missense probably benign 0.00
R9009:Mstn UTSW 1 53,103,131 (GRCm39) nonsense probably null
R9564:Mstn UTSW 1 53,103,367 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGTTCATGCTGATTGCTGC -3'
(R):5'- TCTCATAAACACTAGGACAGCAGTC -3'

Sequencing Primer
(F):5'- CTGGCCCAGTGGATCTAAATG -3'
(R):5'- GATATACTTACACTCTGTAGGCATGG -3'
Posted On 2015-04-06