Mutagenetix > Incidental Mutation

Incidental Mutation 'R3852:Rusc2'

275957

Institutional Source

Beutler Lab

Gene Symbol

Rusc2

Ensembl Gene

ENSMUSG00000035969

Gene Name

RUN and SH3 domain containing 2

Synonyms

MMRRC Submission

040784-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.158) question?

Stock #

R3852 (G1)

Quality Score

180

Status

Validated

Chromosome

Chromosomal Location

43381979-43427088 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 43416424 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 577 (Q577K)

Ref Sequence

ENSEMBL: ENSMUSP00000095710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035645] [ENSMUST00000098106] [ENSMUST00000125399] [ENSMUST00000131668] [ENSMUST00000135216] [ENSMUST00000136360] [ENSMUST00000139198] [ENSMUST00000144911] [ENSMUST00000152322] [ENSMUST00000149221] [ENSMUST00000173682]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000035645
AA Change: Q577K

PolyPhen 2 Score 0.446 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000038379
Gene: ENSMUSG00000035969
AA Change: Q577K

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC
low complexity region	212	230	N/A	INTRINSIC
low complexity region	253	265	N/A	INTRINSIC
low complexity region	411	427	N/A	INTRINSIC
low complexity region	435	448	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	600	617	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
RUN	1109	1177	3.66e-21	SMART
low complexity region	1235	1260	N/A	INTRINSIC
low complexity region	1289	1324	N/A	INTRINSIC
low complexity region	1330	1341	N/A	INTRINSIC
SH3	1457	1512	7.4e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000098106
AA Change: Q577K

PolyPhen 2 Score 0.446 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000095710
Gene: ENSMUSG00000035969
AA Change: Q577K

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC
low complexity region	212	230	N/A	INTRINSIC
low complexity region	253	265	N/A	INTRINSIC
low complexity region	411	427	N/A	INTRINSIC
low complexity region	435	448	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	600	617	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
RUN	1109	1177	3.66e-21	SMART
low complexity region	1235	1260	N/A	INTRINSIC
low complexity region	1289	1324	N/A	INTRINSIC
low complexity region	1330	1341	N/A	INTRINSIC
SH3	1457	1512	7.4e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125393

Predicted Effect

probably benign
Transcript: ENSMUST00000125399

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131037

Predicted Effect

probably benign
Transcript: ENSMUST00000131668
AA Change: Q577K

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000118528
Gene: ENSMUSG00000035969
AA Change: Q577K

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC
low complexity region	212	230	N/A	INTRINSIC
low complexity region	253	265	N/A	INTRINSIC
low complexity region	411	427	N/A	INTRINSIC
low complexity region	435	448	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	600	617	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
RUN	1109	1177	3.66e-21	SMART
low complexity region	1235	1260	N/A	INTRINSIC
low complexity region	1289	1324	N/A	INTRINSIC
low complexity region	1330	1341	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135216

Predicted Effect

probably benign
Transcript: ENSMUST00000136360

SMART Domains

Protein: ENSMUSP00000123431
Gene: ENSMUSG00000035969

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139198

SMART Domains

Protein: ENSMUSP00000121528
Gene: ENSMUSG00000035969

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000144911

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150066

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146710

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149556

Predicted Effect

probably benign
Transcript: ENSMUST00000152322

Predicted Effect

probably benign
Transcript: ENSMUST00000149221

Predicted Effect

probably benign
Transcript: ENSMUST00000173682

SMART Domains

Protein: ENSMUSP00000133715
Gene: ENSMUSG00000035969

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC
low complexity region	212	230	N/A	INTRINSIC
low complexity region	253	265	N/A	INTRINSIC
low complexity region	411	427	N/A	INTRINSIC
low complexity region	435	448	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	685	703	N/A	INTRINSIC
low complexity region	733	740	N/A	INTRINSIC

Meta Mutation Damage Score

0.0705

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

96% (45/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RUN and SH3 domain containing protein that interacts with Rab1b and Rab1-binding protein GM130. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2012]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcf3	T	C	16: 20,560,439	V685A	probably damaging	Het
Abhd4	T	C	14: 54,265,367	Y44H	probably damaging	Het
AI429214	A	G	8: 36,994,442	D248G	probably damaging	Het
AY358078	A	G	14: 51,805,553	T233A	unknown	Het
Calcr	T	C	6: 3,693,735	Y353C	probably damaging	Het
Ccdc34	A	G	2: 110,032,428	K193E	possibly damaging	Het
Dhcr24	A	G	4: 106,573,873	E253G	probably benign	Het
Dnah6	A	G	6: 73,127,927	V1841A	possibly damaging	Het
Dpp10	A	T	1: 123,485,924	Y186*	probably null	Het
Dpysl4	C	T	7: 139,100,935	T575M	probably damaging	Het
Dusp7	T	A	9: 106,373,893	S406T	probably benign	Het
Gga3	T	A	11: 115,587,542	T475S	probably benign	Het
Gm10271	T	A	10: 116,956,874	K36*	probably null	Het
Gm572	G	A	4: 148,668,872	E325K	possibly damaging	Het
Golga2	A	G	2: 32,305,611	E806G	probably benign	Het
Igf1	A	T	10: 87,915,319	K126*	probably null	Het
Itpkc	A	T	7: 27,227,612	N292K	probably benign	Het
Klhl1	A	T	14: 96,280,205	M345K	probably benign	Het
Lrp2	A	G	2: 69,537,565	V201A	probably damaging	Het
Lrrc8a	C	T	2: 30,261,960	T757M	probably benign	Het
Mios	T	A	6: 8,216,453	I459K	probably benign	Het
Mrps11	T	C	7: 78,790,645	I94T	probably damaging	Het
Ms4a4c	T	A	19: 11,416,395	S68T	probably benign	Het
Mstn	C	T	1: 53,061,971	T69I	possibly damaging	Het
Myo10	A	G	15: 25,779,626	K28E	probably damaging	Het
Nol6	A	G	4: 41,117,452	S914P	probably damaging	Het
Ntn1	C	G	11: 68,385,793	D110H	probably damaging	Het
Olfr547	C	A	7: 102,535,280	H178N	probably benign	Het
Olfr585	T	C	7: 103,098,184	S148P	probably damaging	Het
Pcdh17	C	T	14: 84,447,259	Q389*	probably null	Het
Pik3r2	G	A	8: 70,770,421	R452C	probably benign	Het
Prr14l	T	C	5: 32,830,345	E602G	probably damaging	Het
Sacm1l	T	A	9: 123,587,576	M534K	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slco4a1	C	T	2: 180,464,091	T22M	probably benign	Het
Svs1	C	T	6: 48,987,994	P312L	possibly damaging	Het
Tas2r104	A	T	6: 131,684,925	C274S	probably benign	Het
Tnrc6c	C	T	11: 117,723,529	R838W	probably damaging	Het
Trim43c	T	A	9: 88,840,401	H33Q	probably damaging	Het
Ttc17	A	T	2: 94,369,413	I411K	possibly damaging	Het
Ttn	G	T	2: 76,751,334	L23072I	possibly damaging	Het
Ttn	A	C	2: 76,955,024	V669G	possibly damaging	Het
Vmn1r60	A	T	7: 5,545,027	F25I	possibly damaging	Het
Vmn2r9	A	G	5: 108,848,131	I217T	probably damaging	Het

Other mutations in Rusc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01358:Rusc2	APN	4	43426116	missense	probably damaging	0.97
IGL01474:Rusc2	APN	4	43416434	missense	probably damaging	0.98
IGL01541:Rusc2	APN	4	43415840	missense	probably benign	0.08
IGL01628:Rusc2	APN	4	43425729	missense	probably damaging	1.00
IGL01969:Rusc2	APN	4	43415738	missense	probably benign	0.02
IGL02030:Rusc2	APN	4	43416095	missense	possibly damaging	0.86
IGL02079:Rusc2	APN	4	43425668	missense	probably benign
IGL02115:Rusc2	APN	4	43426136	splice site	probably benign
IGL02122:Rusc2	APN	4	43421685	missense	possibly damaging	0.67
IGL02350:Rusc2	APN	4	43425351	missense	possibly damaging	0.86
IGL02357:Rusc2	APN	4	43425351	missense	possibly damaging	0.86
IGL02437:Rusc2	APN	4	43415545	missense	probably damaging	1.00
IGL02930:Rusc2	APN	4	43416376	missense	probably damaging	0.99
IGL03154:Rusc2	APN	4	43425806	missense	probably benign	0.00
P0026:Rusc2	UTSW	4	43415840	missense	possibly damaging	0.93
R0036:Rusc2	UTSW	4	43424009	missense	probably damaging	1.00
R0068:Rusc2	UTSW	4	43424100	splice site	probably benign
R0068:Rusc2	UTSW	4	43424100	splice site	probably benign
R0114:Rusc2	UTSW	4	43422055	missense	probably damaging	1.00
R0255:Rusc2	UTSW	4	43423954	missense	probably damaging	1.00
R0471:Rusc2	UTSW	4	43425486	missense	probably damaging	0.99
R1381:Rusc2	UTSW	4	43416137	missense	probably damaging	1.00
R1413:Rusc2	UTSW	4	43416568	missense	probably benign	0.00
R1416:Rusc2	UTSW	4	43421617	missense	possibly damaging	0.86
R1731:Rusc2	UTSW	4	43426046	missense	probably benign
R1864:Rusc2	UTSW	4	43421719	missense	possibly damaging	0.49
R1897:Rusc2	UTSW	4	43421749	missense	probably damaging	1.00
R2010:Rusc2	UTSW	4	43415212	missense	probably benign	0.06
R2212:Rusc2	UTSW	4	43415935	missense	probably damaging	1.00
R2275:Rusc2	UTSW	4	43416260	missense	probably damaging	1.00
R2885:Rusc2	UTSW	4	43415456	missense	probably benign	0.28
R2886:Rusc2	UTSW	4	43415456	missense	probably benign	0.28
R3412:Rusc2	UTSW	4	43415935	missense	probably damaging	1.00
R3413:Rusc2	UTSW	4	43415935	missense	probably damaging	1.00
R3414:Rusc2	UTSW	4	43415935	missense	probably damaging	1.00
R4135:Rusc2	UTSW	4	43425563	missense	possibly damaging	0.49
R4272:Rusc2	UTSW	4	43415533	missense	probably damaging	1.00
R4574:Rusc2	UTSW	4	43416080	missense	probably damaging	0.99
R4888:Rusc2	UTSW	4	43423942	missense	probably damaging	1.00
R5010:Rusc2	UTSW	4	43415926	missense	probably damaging	1.00
R5071:Rusc2	UTSW	4	43415240	missense	probably benign	0.05
R5131:Rusc2	UTSW	4	43414948	missense	probably benign	0.03
R5177:Rusc2	UTSW	4	43421805	splice site	probably null
R5540:Rusc2	UTSW	4	43423975	missense	probably damaging	1.00
R5561:Rusc2	UTSW	4	43415932	nonsense	probably null
R5628:Rusc2	UTSW	4	43425348	missense	probably damaging	1.00
R5645:Rusc2	UTSW	4	43425758	missense	probably benign	0.06
R6129:Rusc2	UTSW	4	43424271	missense	probably damaging	1.00
R6362:Rusc2	UTSW	4	43416416	missense	probably benign	0.30
R6633:Rusc2	UTSW	4	43414852	missense	probably damaging	0.99
R6980:Rusc2	UTSW	4	43422846	missense	probably benign	0.35
R7491:Rusc2	UTSW	4	43426528	missense	probably damaging	1.00
R7641:Rusc2	UTSW	4	43425335	missense	possibly damaging	0.84
R7698:Rusc2	UTSW	4	43414900	nonsense	probably null
R7710:Rusc2	UTSW	4	43416119	missense	probably benign	0.07
R8052:Rusc2	UTSW	4	43421851	missense	probably benign
R8061:Rusc2	UTSW	4	43422492	missense	probably damaging	1.00
R8127:Rusc2	UTSW	4	43423747	missense	possibly damaging	0.54
R8319:Rusc2	UTSW	4	43425378	missense	probably damaging	1.00
R8355:Rusc2	UTSW	4	43422846	missense	probably benign	0.35
R8397:Rusc2	UTSW	4	43424206	missense	possibly damaging	0.95
R8455:Rusc2	UTSW	4	43422846	missense	probably benign	0.35
R8553:Rusc2	UTSW	4	43416508	missense	probably benign	0.05
R8725:Rusc2	UTSW	4	43401351	intron	probably benign
R8725:Rusc2	UTSW	4	43415396	missense	probably damaging	0.99
R8727:Rusc2	UTSW	4	43401351	intron	probably benign
R8834:Rusc2	UTSW	4	43416431	missense	possibly damaging	0.94
R9295:Rusc2	UTSW	4	43416382	missense	probably damaging	0.98
R9483:Rusc2	UTSW	4	43415897	missense	probably damaging	0.97
R9666:Rusc2	UTSW	4	43416262	missense	probably benign	0.21
R9705:Rusc2	UTSW	4	43424936	missense	probably benign	0.00
X0025:Rusc2	UTSW	4	43422226	missense	probably benign	0.00
X0066:Rusc2	UTSW	4	43422204	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GAAGCTATGACCGTAGCCTG -3'
(R):5'- TAGGAAGTGGCATCTCGCTG -3'

Sequencing Primer
(F):5'- CGCCTGGGCTCACTAGAG -3'
(R):5'- AAGTGGCATCTCGCTGGACTG -3'

Posted On

2015-04-06