Incidental Mutation 'R3852:Prr14l'
ID275961
Institutional Source Beutler Lab
Gene Symbol Prr14l
Ensembl Gene ENSMUSG00000054280
Gene Nameproline rich 14-like
Synonyms
MMRRC Submission 040784-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R3852 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location32789820-32854256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32830345 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 602 (E602G)
Ref Sequence ENSEMBL: ENSMUSP00000113259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120129] [ENSMUST00000144673] [ENSMUST00000155392]
Predicted Effect probably damaging
Transcript: ENSMUST00000120129
AA Change: E602G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113259
Gene: ENSMUSG00000054280
AA Change: E602G

DomainStartEndE-ValueType
low complexity region 720 731 N/A INTRINSIC
low complexity region 1433 1446 N/A INTRINSIC
low complexity region 1471 1480 N/A INTRINSIC
Pfam:Tantalus 1838 1895 2.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144673
SMART Domains Protein: ENSMUSP00000124923
Gene: ENSMUSG00000093574

DomainStartEndE-ValueType
Pfam:Tantalus 158 193 1.2e-15 PFAM
Pfam:PS_Dcarbxylase 332 575 2.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155392
SMART Domains Protein: ENSMUSP00000119569
Gene: ENSMUSG00000054280

DomainStartEndE-ValueType
low complexity region 276 289 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
Meta Mutation Damage Score 0.0918 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T C 16: 20,560,439 V685A probably damaging Het
Abhd4 T C 14: 54,265,367 Y44H probably damaging Het
AI429214 A G 8: 36,994,442 D248G probably damaging Het
AY358078 A G 14: 51,805,553 T233A unknown Het
Calcr T C 6: 3,693,735 Y353C probably damaging Het
Ccdc34 A G 2: 110,032,428 K193E possibly damaging Het
Dhcr24 A G 4: 106,573,873 E253G probably benign Het
Dnah6 A G 6: 73,127,927 V1841A possibly damaging Het
Dpp10 A T 1: 123,485,924 Y186* probably null Het
Dpysl4 C T 7: 139,100,935 T575M probably damaging Het
Dusp7 T A 9: 106,373,893 S406T probably benign Het
Gga3 T A 11: 115,587,542 T475S probably benign Het
Gm10271 T A 10: 116,956,874 K36* probably null Het
Gm572 G A 4: 148,668,872 E325K possibly damaging Het
Golga2 A G 2: 32,305,611 E806G probably benign Het
Igf1 A T 10: 87,915,319 K126* probably null Het
Itpkc A T 7: 27,227,612 N292K probably benign Het
Klhl1 A T 14: 96,280,205 M345K probably benign Het
Lrp2 A G 2: 69,537,565 V201A probably damaging Het
Lrrc8a C T 2: 30,261,960 T757M probably benign Het
Mios T A 6: 8,216,453 I459K probably benign Het
Mrps11 T C 7: 78,790,645 I94T probably damaging Het
Ms4a4c T A 19: 11,416,395 S68T probably benign Het
Mstn C T 1: 53,061,971 T69I possibly damaging Het
Myo10 A G 15: 25,779,626 K28E probably damaging Het
Nol6 A G 4: 41,117,452 S914P probably damaging Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr547 C A 7: 102,535,280 H178N probably benign Het
Olfr585 T C 7: 103,098,184 S148P probably damaging Het
Pcdh17 C T 14: 84,447,259 Q389* probably null Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Rusc2 C A 4: 43,416,424 Q577K probably benign Het
Sacm1l T A 9: 123,587,576 M534K probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco4a1 C T 2: 180,464,091 T22M probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tas2r104 A T 6: 131,684,925 C274S probably benign Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trim43c T A 9: 88,840,401 H33Q probably damaging Het
Ttc17 A T 2: 94,369,413 I411K possibly damaging Het
Ttn G T 2: 76,751,334 L23072I possibly damaging Het
Ttn A C 2: 76,955,024 V669G possibly damaging Het
Vmn1r60 A T 7: 5,545,027 F25I possibly damaging Het
Vmn2r9 A G 5: 108,848,131 I217T probably damaging Het
Other mutations in Prr14l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Prr14l APN 5 32830676 missense probably benign 0.04
IGL00331:Prr14l APN 5 32831066 missense probably benign 0.02
IGL01571:Prr14l APN 5 32828806 missense probably benign 0.01
IGL01795:Prr14l APN 5 32831845 unclassified probably benign
IGL01929:Prr14l APN 5 32828243 missense probably benign 0.09
IGL01959:Prr14l APN 5 32830205 missense possibly damaging 0.84
IGL02139:Prr14l APN 5 32827532 missense probably damaging 1.00
IGL02321:Prr14l APN 5 32827807 missense probably benign 0.10
IGL02508:Prr14l APN 5 32830942 missense probably benign 0.01
IGL02551:Prr14l APN 5 32831484 missense probably damaging 1.00
IGL02585:Prr14l APN 5 32829484 missense possibly damaging 0.59
IGL02614:Prr14l APN 5 32830543 missense possibly damaging 0.76
IGL02808:Prr14l APN 5 32828182 missense possibly damaging 0.94
IGL02836:Prr14l APN 5 32831096 missense probably benign 0.42
IGL02952:Prr14l APN 5 32835670 missense unknown
IGL03034:Prr14l APN 5 32827438 missense possibly damaging 0.48
Polymer UTSW 5 32827145 missense probably benign 0.34
Postwar UTSW 5 32830684 missense probably benign 0.17
H8562:Prr14l UTSW 5 32793728 missense probably damaging 1.00
R0086:Prr14l UTSW 5 32831559 unclassified probably benign
R0149:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0333:Prr14l UTSW 5 32827993 missense probably damaging 1.00
R0361:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0416:Prr14l UTSW 5 32828717 missense probably benign 0.25
R0480:Prr14l UTSW 5 32829880 missense probably benign 0.02
R0511:Prr14l UTSW 5 32844216 intron probably benign
R0639:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0673:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0743:Prr14l UTSW 5 32831194 missense possibly damaging 0.55
R0792:Prr14l UTSW 5 32828423 missense probably damaging 1.00
R1006:Prr14l UTSW 5 32829482 missense probably benign 0.00
R1342:Prr14l UTSW 5 32830260 missense probably damaging 1.00
R1433:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R1527:Prr14l UTSW 5 32827949 missense possibly damaging 0.75
R1704:Prr14l UTSW 5 32830282 missense probably benign 0.01
R1967:Prr14l UTSW 5 32844469 intron probably benign
R2129:Prr14l UTSW 5 32831828 unclassified probably benign
R2150:Prr14l UTSW 5 32830702 missense probably benign 0.14
R2318:Prr14l UTSW 5 32830078 missense probably benign 0.04
R2915:Prr14l UTSW 5 32829768 missense probably benign 0.04
R3551:Prr14l UTSW 5 32828619 splice site probably null
R3820:Prr14l UTSW 5 32828984 missense probably damaging 0.99
R4126:Prr14l UTSW 5 32828003 missense probably damaging 0.97
R4345:Prr14l UTSW 5 32828576 missense probably damaging 1.00
R4388:Prr14l UTSW 5 32829254 missense probably damaging 1.00
R4575:Prr14l UTSW 5 32793644 missense probably damaging 1.00
R4596:Prr14l UTSW 5 32829308 missense probably benign 0.01
R4690:Prr14l UTSW 5 32844156 intron probably benign
R4824:Prr14l UTSW 5 32844399 intron probably benign
R4868:Prr14l UTSW 5 32829937 missense probably benign 0.04
R4869:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R5201:Prr14l UTSW 5 32830247 missense possibly damaging 0.52
R5328:Prr14l UTSW 5 32830021 missense probably benign 0.00
R5410:Prr14l UTSW 5 32827777 missense probably damaging 0.98
R5476:Prr14l UTSW 5 32844138 intron probably benign
R5623:Prr14l UTSW 5 32844508 intron probably benign
R5730:Prr14l UTSW 5 32793603 missense probably damaging 1.00
R5988:Prr14l UTSW 5 32830851 missense probably damaging 0.98
R6261:Prr14l UTSW 5 32829404 missense possibly damaging 0.46
R6283:Prr14l UTSW 5 32830264 missense probably benign 0.14
R6307:Prr14l UTSW 5 32827525 missense probably damaging 0.97
R6825:Prr14l UTSW 5 32828548 missense possibly damaging 0.86
R6862:Prr14l UTSW 5 32827759 missense probably damaging 1.00
R6880:Prr14l UTSW 5 32830867 missense probably benign 0.01
R6931:Prr14l UTSW 5 32830691 missense probably damaging 0.98
R7101:Prr14l UTSW 5 32829427 missense probably damaging 1.00
R7164:Prr14l UTSW 5 32829166 missense probably damaging 1.00
R7203:Prr14l UTSW 5 32827145 missense probably benign 0.34
R7211:Prr14l UTSW 5 32830087 missense probably damaging 0.98
R7305:Prr14l UTSW 5 32831101 missense probably benign 0.14
R7346:Prr14l UTSW 5 32830684 missense probably benign 0.17
R7395:Prr14l UTSW 5 32828638 missense probably benign 0.00
R7624:Prr14l UTSW 5 32829623 missense possibly damaging 0.54
R7649:Prr14l UTSW 5 32828245 missense probably benign 0.18
R7753:Prr14l UTSW 5 32827253 missense probably damaging 1.00
R7828:Prr14l UTSW 5 32844391 intron probably benign
R7898:Prr14l UTSW 5 32829966 missense probably benign 0.04
R8071:Prr14l UTSW 5 32831164 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCAGTTCACAGGCAGCAGAAG -3'
(R):5'- TGTGACAACTGGCTCTCTAAG -3'

Sequencing Primer
(F):5'- AGCAGAAGCAGAACACATGTTC -3'
(R):5'- ACTGGCTCTCTAAGTATAAACAGAG -3'
Posted On2015-04-06