Incidental Mutation 'R3852:Vmn2r9'
ID275963
Institutional Source Beutler Lab
Gene Symbol Vmn2r9
Ensembl Gene ENSMUSG00000091624
Gene Namevomeronasal 2, receptor 9
SynonymsEG435864
MMRRC Submission 040784-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R3852 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location108842947-108852510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108848131 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 217 (I217T)
Ref Sequence ENSEMBL: ENSMUSP00000129520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170419]
Predicted Effect probably damaging
Transcript: ENSMUST00000170419
AA Change: I217T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129520
Gene: ENSMUSG00000091624
AA Change: I217T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 77 412 8.1e-29 PFAM
Pfam:NCD3G 507 561 2.3e-16 PFAM
Pfam:7tm_3 592 829 3.4e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176157
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T C 16: 20,560,439 V685A probably damaging Het
Abhd4 T C 14: 54,265,367 Y44H probably damaging Het
AI429214 A G 8: 36,994,442 D248G probably damaging Het
AY358078 A G 14: 51,805,553 T233A unknown Het
Calcr T C 6: 3,693,735 Y353C probably damaging Het
Ccdc34 A G 2: 110,032,428 K193E possibly damaging Het
Dhcr24 A G 4: 106,573,873 E253G probably benign Het
Dnah6 A G 6: 73,127,927 V1841A possibly damaging Het
Dpp10 A T 1: 123,485,924 Y186* probably null Het
Dpysl4 C T 7: 139,100,935 T575M probably damaging Het
Dusp7 T A 9: 106,373,893 S406T probably benign Het
Gga3 T A 11: 115,587,542 T475S probably benign Het
Gm10271 T A 10: 116,956,874 K36* probably null Het
Gm572 G A 4: 148,668,872 E325K possibly damaging Het
Golga2 A G 2: 32,305,611 E806G probably benign Het
Igf1 A T 10: 87,915,319 K126* probably null Het
Itpkc A T 7: 27,227,612 N292K probably benign Het
Klhl1 A T 14: 96,280,205 M345K probably benign Het
Lrp2 A G 2: 69,537,565 V201A probably damaging Het
Lrrc8a C T 2: 30,261,960 T757M probably benign Het
Mios T A 6: 8,216,453 I459K probably benign Het
Mrps11 T C 7: 78,790,645 I94T probably damaging Het
Ms4a4c T A 19: 11,416,395 S68T probably benign Het
Mstn C T 1: 53,061,971 T69I possibly damaging Het
Myo10 A G 15: 25,779,626 K28E probably damaging Het
Nol6 A G 4: 41,117,452 S914P probably damaging Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr547 C A 7: 102,535,280 H178N probably benign Het
Olfr585 T C 7: 103,098,184 S148P probably damaging Het
Pcdh17 C T 14: 84,447,259 Q389* probably null Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Prr14l T C 5: 32,830,345 E602G probably damaging Het
Rusc2 C A 4: 43,416,424 Q577K probably benign Het
Sacm1l T A 9: 123,587,576 M534K probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco4a1 C T 2: 180,464,091 T22M probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tas2r104 A T 6: 131,684,925 C274S probably benign Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trim43c T A 9: 88,840,401 H33Q probably damaging Het
Ttc17 A T 2: 94,369,413 I411K possibly damaging Het
Ttn G T 2: 76,751,334 L23072I possibly damaging Het
Ttn A C 2: 76,955,024 V669G possibly damaging Het
Vmn1r60 A T 7: 5,545,027 F25I possibly damaging Het
Other mutations in Vmn2r9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Vmn2r9 APN 5 108848024 missense possibly damaging 0.79
IGL00972:Vmn2r9 APN 5 108849037 missense probably benign 0.02
IGL01102:Vmn2r9 APN 5 108842945 unclassified probably null
IGL01892:Vmn2r9 APN 5 108847834 missense probably damaging 1.00
IGL02086:Vmn2r9 APN 5 108847567 missense probably damaging 1.00
IGL02118:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02119:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02120:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02121:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02123:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02131:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02132:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02171:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02185:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02186:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02346:Vmn2r9 APN 5 108842984 missense probably benign 0.07
IGL02508:Vmn2r9 APN 5 108848201 missense possibly damaging 0.70
IGL02815:Vmn2r9 APN 5 108842990 missense possibly damaging 0.69
IGL03077:Vmn2r9 APN 5 108848307 splice site probably benign
IGL03269:Vmn2r9 APN 5 108847954 missense probably damaging 1.00
IGL03293:Vmn2r9 APN 5 108848131 missense probably damaging 1.00
R0112:Vmn2r9 UTSW 5 108843125 missense probably damaging 1.00
R0328:Vmn2r9 UTSW 5 108847539 missense probably benign 0.11
R0382:Vmn2r9 UTSW 5 108847597 missense probably damaging 1.00
R0521:Vmn2r9 UTSW 5 108848288 nonsense probably null
R0975:Vmn2r9 UTSW 5 108843303 missense probably damaging 1.00
R1216:Vmn2r9 UTSW 5 108847574 missense probably damaging 1.00
R1458:Vmn2r9 UTSW 5 108848984 missense probably benign 0.44
R1469:Vmn2r9 UTSW 5 108843828 missense probably benign
R1469:Vmn2r9 UTSW 5 108843828 missense probably benign
R1704:Vmn2r9 UTSW 5 108846400 missense probably damaging 1.00
R1967:Vmn2r9 UTSW 5 108847522 missense probably benign 0.03
R1991:Vmn2r9 UTSW 5 108846439 missense probably damaging 0.99
R2410:Vmn2r9 UTSW 5 108848257 missense probably damaging 1.00
R3419:Vmn2r9 UTSW 5 108846433 missense probably damaging 0.96
R3873:Vmn2r9 UTSW 5 108847835 missense probably benign 0.14
R3905:Vmn2r9 UTSW 5 108847919 missense probably benign 0.37
R3908:Vmn2r9 UTSW 5 108847919 missense probably benign 0.37
R3921:Vmn2r9 UTSW 5 108849055 missense probably benign
R4156:Vmn2r9 UTSW 5 108847877 missense possibly damaging 0.64
R4477:Vmn2r9 UTSW 5 108846277 missense probably benign
R4478:Vmn2r9 UTSW 5 108846277 missense probably benign
R4544:Vmn2r9 UTSW 5 108847685 missense probably benign 0.00
R4546:Vmn2r9 UTSW 5 108847685 missense probably benign 0.00
R4627:Vmn2r9 UTSW 5 108847597 missense probably damaging 1.00
R5215:Vmn2r9 UTSW 5 108846485 missense probably benign 0.03
R5361:Vmn2r9 UTSW 5 108848063 missense probably damaging 1.00
R5587:Vmn2r9 UTSW 5 108847561 missense probably damaging 1.00
R6054:Vmn2r9 UTSW 5 108848260 missense probably damaging 0.99
R6106:Vmn2r9 UTSW 5 108845036 missense probably benign
R6125:Vmn2r9 UTSW 5 108842970 missense probably benign 0.01
R6137:Vmn2r9 UTSW 5 108849016 missense probably benign 0.00
R6920:Vmn2r9 UTSW 5 108849046 missense possibly damaging 0.72
R7579:Vmn2r9 UTSW 5 108845082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTCTAAAGCTGACTTCTAGGG -3'
(R):5'- ACCCCTTATGTGGGTGTCTC -3'

Sequencing Primer
(F):5'- AAAGCTGACTTCTAGGGTAGAGTTC -3'
(R):5'- ATGTGGGTGTCTCATCCTCTC -3'
Posted On2015-04-06