Incidental Mutation 'R3852:Svs1'
ID275966
Institutional Source Beutler Lab
Gene Symbol Svs1
Ensembl Gene ENSMUSG00000039215
Gene Nameseminal vesicle secretory protein 1
SynonymsSVS I
MMRRC Submission 040784-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R3852 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location48986861-48991722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 48987994 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 312 (P312L)
Ref Sequence ENSEMBL: ENSMUSP00000045221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037696]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037696
AA Change: P312L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045221
Gene: ENSMUSG00000039215
AA Change: P312L

DomainStartEndE-ValueType
Pfam:Cu_amine_oxidN2 44 130 1.5e-24 PFAM
Pfam:Cu_amine_oxidN3 146 246 2.7e-16 PFAM
internal_repeat_1 286 342 7.28e-22 PROSPERO
Pfam:Cu_amine_oxid 408 811 2e-92 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203494
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T C 16: 20,560,439 V685A probably damaging Het
Abhd4 T C 14: 54,265,367 Y44H probably damaging Het
AI429214 A G 8: 36,994,442 D248G probably damaging Het
AY358078 A G 14: 51,805,553 T233A unknown Het
Calcr T C 6: 3,693,735 Y353C probably damaging Het
Ccdc34 A G 2: 110,032,428 K193E possibly damaging Het
Dhcr24 A G 4: 106,573,873 E253G probably benign Het
Dnah6 A G 6: 73,127,927 V1841A possibly damaging Het
Dpp10 A T 1: 123,485,924 Y186* probably null Het
Dpysl4 C T 7: 139,100,935 T575M probably damaging Het
Dusp7 T A 9: 106,373,893 S406T probably benign Het
Gga3 T A 11: 115,587,542 T475S probably benign Het
Gm10271 T A 10: 116,956,874 K36* probably null Het
Gm572 G A 4: 148,668,872 E325K possibly damaging Het
Golga2 A G 2: 32,305,611 E806G probably benign Het
Igf1 A T 10: 87,915,319 K126* probably null Het
Itpkc A T 7: 27,227,612 N292K probably benign Het
Klhl1 A T 14: 96,280,205 M345K probably benign Het
Lrp2 A G 2: 69,537,565 V201A probably damaging Het
Lrrc8a C T 2: 30,261,960 T757M probably benign Het
Mios T A 6: 8,216,453 I459K probably benign Het
Mrps11 T C 7: 78,790,645 I94T probably damaging Het
Ms4a4c T A 19: 11,416,395 S68T probably benign Het
Mstn C T 1: 53,061,971 T69I possibly damaging Het
Myo10 A G 15: 25,779,626 K28E probably damaging Het
Nol6 A G 4: 41,117,452 S914P probably damaging Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr547 C A 7: 102,535,280 H178N probably benign Het
Olfr585 T C 7: 103,098,184 S148P probably damaging Het
Pcdh17 C T 14: 84,447,259 Q389* probably null Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Prr14l T C 5: 32,830,345 E602G probably damaging Het
Rusc2 C A 4: 43,416,424 Q577K probably benign Het
Sacm1l T A 9: 123,587,576 M534K probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco4a1 C T 2: 180,464,091 T22M probably benign Het
Tas2r104 A T 6: 131,684,925 C274S probably benign Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trim43c T A 9: 88,840,401 H33Q probably damaging Het
Ttc17 A T 2: 94,369,413 I411K possibly damaging Het
Ttn G T 2: 76,751,334 L23072I possibly damaging Het
Ttn A C 2: 76,955,024 V669G possibly damaging Het
Vmn1r60 A T 7: 5,545,027 F25I possibly damaging Het
Vmn2r9 A G 5: 108,848,131 I217T probably damaging Het
Other mutations in Svs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Svs1 APN 6 48987739 missense probably damaging 0.98
IGL01876:Svs1 APN 6 48990036 missense possibly damaging 0.71
IGL01934:Svs1 APN 6 48988761 missense probably damaging 0.97
IGL03002:Svs1 APN 6 48987118 missense probably benign 0.01
IGL03059:Svs1 APN 6 48987415 missense probably benign 0.13
IGL03213:Svs1 APN 6 48988345 missense possibly damaging 0.92
IGL03249:Svs1 APN 6 48988369 missense probably benign
IGL03365:Svs1 APN 6 48988597 missense probably damaging 0.97
PIT4280001:Svs1 UTSW 6 48987120 missense probably benign 0.01
PIT4495001:Svs1 UTSW 6 48987776 missense possibly damaging 0.92
R0010:Svs1 UTSW 6 48988906 missense probably damaging 0.99
R0528:Svs1 UTSW 6 48988031 missense probably benign
R0784:Svs1 UTSW 6 48987301 missense possibly damaging 0.78
R0959:Svs1 UTSW 6 48988632 missense possibly damaging 0.89
R1173:Svs1 UTSW 6 48990239 missense probably damaging 1.00
R1174:Svs1 UTSW 6 48990239 missense probably damaging 1.00
R1175:Svs1 UTSW 6 48990239 missense probably damaging 1.00
R1940:Svs1 UTSW 6 48990073 nonsense probably null
R3115:Svs1 UTSW 6 48987397 missense probably damaging 0.99
R3116:Svs1 UTSW 6 48987397 missense probably damaging 0.99
R3808:Svs1 UTSW 6 48987994 missense possibly damaging 0.93
R3809:Svs1 UTSW 6 48987994 missense possibly damaging 0.93
R4455:Svs1 UTSW 6 48987460 missense possibly damaging 0.56
R4898:Svs1 UTSW 6 48987717 missense possibly damaging 0.95
R4933:Svs1 UTSW 6 48987492 missense probably damaging 1.00
R5108:Svs1 UTSW 6 48988570 missense probably damaging 0.97
R5320:Svs1 UTSW 6 48987575 missense probably benign 0.02
R6053:Svs1 UTSW 6 48988488 missense probably benign 0.42
R6728:Svs1 UTSW 6 48988845 missense possibly damaging 0.86
R6922:Svs1 UTSW 6 48987574 missense probably damaging 0.99
R7045:Svs1 UTSW 6 48988612 missense possibly damaging 0.81
R7046:Svs1 UTSW 6 48987578 missense probably benign 0.11
R7137:Svs1 UTSW 6 48990149 missense probably damaging 1.00
R7267:Svs1 UTSW 6 48988018 small deletion probably benign
R7874:Svs1 UTSW 6 48988666 missense possibly damaging 0.91
R7993:Svs1 UTSW 6 48987608 missense possibly damaging 0.85
R8238:Svs1 UTSW 6 48990041 missense probably damaging 0.96
X0022:Svs1 UTSW 6 48988339 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAACTGGCTCAGAAATATGC -3'
(R):5'- TGATGGGCATGGGAAATTTAGC -3'

Sequencing Primer
(F):5'- CTGGCTCAGAAATATGCAGATG -3'
(R):5'- CATGGGAAATTTAGCATGGGGC -3'
Posted On2015-04-06