Incidental Mutation 'R3852:Dnah6'
ID 275967
Institutional Source Beutler Lab
Gene Symbol Dnah6
Ensembl Gene ENSMUSG00000052861
Gene Name dynein, axonemal, heavy chain 6
Synonyms A730004I20Rik, Dnahc6
MMRRC Submission 040784-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R3852 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 72994589-73198634 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73104910 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1841 (V1841A)
Ref Sequence ENSEMBL: ENSMUSP00000109674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064948] [ENSMUST00000114040] [ENSMUST00000204053]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000064948
AA Change: V1893A

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000068758
Gene: ENSMUSG00000052861
AA Change: V1893A

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114038
SMART Domains Protein: ENSMUSP00000109672
Gene: ENSMUSG00000052861

DomainStartEndE-ValueType
Pfam:AAA_6 1 109 6.9e-45 PFAM
AAA 190 331 5.25e-1 SMART
low complexity region 407 417 N/A INTRINSIC
AAA 533 686 1.01e-3 SMART
AAA 884 1042 3.08e0 SMART
low complexity region 1057 1068 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Pfam:MT 1135 1267 1.1e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114040
AA Change: V1841A

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109674
Gene: ENSMUSG00000052861
AA Change: V1841A

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 873 1300 2.2e-135 PFAM
AAA 1407 1510 2.76e-1 SMART
AAA 1688 1829 5.25e-1 SMART
low complexity region 1905 1915 N/A INTRINSIC
AAA 2031 2184 1.01e-3 SMART
AAA 2382 2540 3.08e0 SMART
low complexity region 2555 2566 N/A INTRINSIC
low complexity region 2593 2604 N/A INTRINSIC
Pfam:MT 2633 2967 1.1e-53 PFAM
Pfam:AAA_9 2984 3214 1e-58 PFAM
Pfam:Dynein_heavy 3344 4089 2.2e-213 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204053
AA Change: V1893A

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144791
Gene: ENSMUSG00000052861
AA Change: V1893A

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Meta Mutation Damage Score 0.1143 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Mutations in this gene may cause primary ciliary dyskinesia (PCD) as well as heterotaxy. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T C 16: 20,379,189 (GRCm39) V685A probably damaging Het
Abhd4 T C 14: 54,502,824 (GRCm39) Y44H probably damaging Het
AI429214 A G 8: 37,461,596 (GRCm39) D248G probably damaging Het
Aoc1l3 C T 6: 48,964,928 (GRCm39) P312L possibly damaging Het
AY358078 A G 14: 52,043,010 (GRCm39) T233A unknown Het
Calcr T C 6: 3,693,735 (GRCm39) Y353C probably damaging Het
Ccdc34 A G 2: 109,862,773 (GRCm39) K193E possibly damaging Het
Dhcr24 A G 4: 106,431,070 (GRCm39) E253G probably benign Het
Dpp10 A T 1: 123,413,653 (GRCm39) Y186* probably null Het
Dpysl4 C T 7: 138,680,851 (GRCm39) T575M probably damaging Het
Dusp7 T A 9: 106,251,092 (GRCm39) S406T probably benign Het
Gga3 T A 11: 115,478,368 (GRCm39) T475S probably benign Het
Gm10271 T A 10: 116,792,779 (GRCm39) K36* probably null Het
Gm572 G A 4: 148,753,329 (GRCm39) E325K possibly damaging Het
Golga2 A G 2: 32,195,623 (GRCm39) E806G probably benign Het
Igf1 A T 10: 87,751,181 (GRCm39) K126* probably null Het
Itpkc A T 7: 26,927,037 (GRCm39) N292K probably benign Het
Klhl1 A T 14: 96,517,641 (GRCm39) M345K probably benign Het
Lrp2 A G 2: 69,367,909 (GRCm39) V201A probably damaging Het
Lrrc8a C T 2: 30,151,972 (GRCm39) T757M probably benign Het
Mios T A 6: 8,216,453 (GRCm39) I459K probably benign Het
Mrps11 T C 7: 78,440,393 (GRCm39) I94T probably damaging Het
Ms4a4c T A 19: 11,393,759 (GRCm39) S68T probably benign Het
Mstn C T 1: 53,101,130 (GRCm39) T69I possibly damaging Het
Myo10 A G 15: 25,779,712 (GRCm39) K28E probably damaging Het
Nol6 A G 4: 41,117,452 (GRCm39) S914P probably damaging Het
Ntn1 C G 11: 68,276,619 (GRCm39) D110H probably damaging Het
Or51f1e T C 7: 102,747,391 (GRCm39) S148P probably damaging Het
Or52b4 C A 7: 102,184,487 (GRCm39) H178N probably benign Het
Pcdh17 C T 14: 84,684,699 (GRCm39) Q389* probably null Het
Pik3r2 G A 8: 71,223,065 (GRCm39) R452C probably benign Het
Prr14l T C 5: 32,987,689 (GRCm39) E602G probably damaging Het
Rusc2 C A 4: 43,416,424 (GRCm39) Q577K probably benign Het
Sacm1l T A 9: 123,416,641 (GRCm39) M534K probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slco4a1 C T 2: 180,105,884 (GRCm39) T22M probably benign Het
Tas2r104 A T 6: 131,661,888 (GRCm39) C274S probably benign Het
Tnrc6c C T 11: 117,614,355 (GRCm39) R838W probably damaging Het
Trim43c T A 9: 88,722,454 (GRCm39) H33Q probably damaging Het
Ttc17 A T 2: 94,199,758 (GRCm39) I411K possibly damaging Het
Ttn G T 2: 76,581,678 (GRCm39) L23072I possibly damaging Het
Ttn A C 2: 76,785,368 (GRCm39) V669G possibly damaging Het
Vmn1r60 A T 7: 5,548,026 (GRCm39) F25I possibly damaging Het
Vmn2r9 A G 5: 108,995,997 (GRCm39) I217T probably damaging Het
Other mutations in Dnah6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Dnah6 APN 6 73,172,720 (GRCm39) missense probably benign 0.00
IGL00488:Dnah6 APN 6 73,063,190 (GRCm39) missense possibly damaging 0.95
IGL00497:Dnah6 APN 6 73,172,744 (GRCm39) missense probably damaging 1.00
IGL00557:Dnah6 APN 6 73,172,603 (GRCm39) missense possibly damaging 0.47
IGL00561:Dnah6 APN 6 73,172,603 (GRCm39) missense possibly damaging 0.47
IGL00563:Dnah6 APN 6 73,172,603 (GRCm39) missense possibly damaging 0.47
IGL00755:Dnah6 APN 6 73,189,417 (GRCm39) critical splice donor site probably null
IGL00756:Dnah6 APN 6 73,100,754 (GRCm39) missense possibly damaging 0.76
IGL00764:Dnah6 APN 6 73,172,603 (GRCm39) missense possibly damaging 0.47
IGL00895:Dnah6 APN 6 73,133,333 (GRCm39) missense possibly damaging 0.67
IGL00922:Dnah6 APN 6 73,010,509 (GRCm39) splice site probably benign
IGL00972:Dnah6 APN 6 73,060,140 (GRCm39) splice site probably benign
IGL00975:Dnah6 APN 6 73,150,373 (GRCm39) missense possibly damaging 0.94
IGL01014:Dnah6 APN 6 73,051,764 (GRCm39) splice site probably benign
IGL01307:Dnah6 APN 6 73,042,708 (GRCm39) missense probably damaging 1.00
IGL01353:Dnah6 APN 6 73,150,439 (GRCm39) missense probably benign 0.01
IGL01362:Dnah6 APN 6 73,069,161 (GRCm39) missense probably damaging 1.00
IGL01373:Dnah6 APN 6 73,051,731 (GRCm39) missense probably benign 0.10
IGL01559:Dnah6 APN 6 73,001,235 (GRCm39) critical splice donor site probably null
IGL01622:Dnah6 APN 6 73,121,701 (GRCm39) missense probably damaging 1.00
IGL01623:Dnah6 APN 6 73,121,701 (GRCm39) missense probably damaging 1.00
IGL01682:Dnah6 APN 6 73,052,785 (GRCm39) missense probably damaging 1.00
IGL01735:Dnah6 APN 6 73,053,643 (GRCm39) nonsense probably null
IGL01736:Dnah6 APN 6 73,165,360 (GRCm39) missense probably benign 0.06
IGL01825:Dnah6 APN 6 73,042,759 (GRCm39) missense probably damaging 1.00
IGL01835:Dnah6 APN 6 73,112,784 (GRCm39) missense probably damaging 1.00
IGL01870:Dnah6 APN 6 73,009,552 (GRCm39) missense probably benign 0.04
IGL01935:Dnah6 APN 6 73,037,126 (GRCm39) missense probably benign
IGL02126:Dnah6 APN 6 73,080,149 (GRCm39) missense probably benign 0.01
IGL02191:Dnah6 APN 6 72,994,780 (GRCm39) missense probably benign 0.00
IGL02293:Dnah6 APN 6 73,110,633 (GRCm39) splice site probably benign
IGL02316:Dnah6 APN 6 73,145,894 (GRCm39) missense probably benign 0.19
IGL02339:Dnah6 APN 6 73,078,881 (GRCm39) missense probably benign 0.00
IGL02380:Dnah6 APN 6 73,053,623 (GRCm39) missense probably benign 0.12
IGL02458:Dnah6 APN 6 73,004,431 (GRCm39) missense probably benign 0.43
IGL02499:Dnah6 APN 6 72,998,210 (GRCm39) missense probably benign 0.12
IGL02652:Dnah6 APN 6 73,072,087 (GRCm39) missense probably damaging 1.00
IGL02668:Dnah6 APN 6 73,098,806 (GRCm39) missense possibly damaging 0.61
IGL02858:Dnah6 APN 6 73,185,582 (GRCm39) missense probably benign 0.03
IGL02875:Dnah6 APN 6 73,115,698 (GRCm39) missense probably damaging 0.99
IGL02878:Dnah6 APN 6 73,009,570 (GRCm39) missense probably benign 0.01
IGL02989:Dnah6 APN 6 73,046,403 (GRCm39) missense probably damaging 1.00
IGL03001:Dnah6 APN 6 73,126,123 (GRCm39) missense probably benign 0.19
IGL03135:Dnah6 APN 6 73,121,987 (GRCm39) missense probably benign 0.00
IGL03145:Dnah6 APN 6 73,018,037 (GRCm39) missense probably damaging 1.00
IGL03202:Dnah6 APN 6 73,121,683 (GRCm39) missense probably damaging 1.00
IGL03282:Dnah6 APN 6 73,030,630 (GRCm39) splice site probably benign
IGL03286:Dnah6 APN 6 73,060,068 (GRCm39) missense probably damaging 1.00
IGL03372:Dnah6 APN 6 73,052,833 (GRCm39) missense probably benign 0.15
P0025:Dnah6 UTSW 6 73,140,487 (GRCm39) missense probably benign 0.00
PIT4305001:Dnah6 UTSW 6 73,042,738 (GRCm39) missense probably benign 0.03
PIT4466001:Dnah6 UTSW 6 73,185,624 (GRCm39) missense probably benign 0.00
PIT4480001:Dnah6 UTSW 6 73,078,863 (GRCm39) missense probably benign 0.00
PIT4515001:Dnah6 UTSW 6 73,091,565 (GRCm39) missense probably damaging 1.00
PIT4651001:Dnah6 UTSW 6 73,037,243 (GRCm39) missense probably benign 0.02
R0103:Dnah6 UTSW 6 73,069,155 (GRCm39) missense probably damaging 1.00
R0103:Dnah6 UTSW 6 73,069,155 (GRCm39) missense probably damaging 1.00
R0105:Dnah6 UTSW 6 73,132,262 (GRCm39) missense probably damaging 0.99
R0105:Dnah6 UTSW 6 73,132,262 (GRCm39) missense probably damaging 0.99
R0127:Dnah6 UTSW 6 73,015,717 (GRCm39) splice site probably benign
R0164:Dnah6 UTSW 6 73,165,518 (GRCm39) splice site probably benign
R0165:Dnah6 UTSW 6 72,998,306 (GRCm39) missense probably benign 0.01
R0183:Dnah6 UTSW 6 73,059,906 (GRCm39) missense probably damaging 1.00
R0200:Dnah6 UTSW 6 73,046,403 (GRCm39) missense probably damaging 1.00
R0304:Dnah6 UTSW 6 73,136,098 (GRCm39) missense probably damaging 1.00
R0324:Dnah6 UTSW 6 73,150,541 (GRCm39) missense possibly damaging 0.86
R0335:Dnah6 UTSW 6 73,046,382 (GRCm39) splice site probably benign
R0345:Dnah6 UTSW 6 72,998,240 (GRCm39) missense probably benign 0.12
R0357:Dnah6 UTSW 6 73,165,342 (GRCm39) missense probably benign
R0362:Dnah6 UTSW 6 73,185,592 (GRCm39) missense probably benign 0.06
R0377:Dnah6 UTSW 6 73,098,975 (GRCm39) missense possibly damaging 0.93
R0386:Dnah6 UTSW 6 73,060,107 (GRCm39) missense probably damaging 0.99
R0547:Dnah6 UTSW 6 73,021,757 (GRCm39) missense probably benign 0.15
R0639:Dnah6 UTSW 6 72,999,395 (GRCm39) missense probably benign 0.02
R0673:Dnah6 UTSW 6 73,100,794 (GRCm39) missense probably benign 0.01
R0690:Dnah6 UTSW 6 73,106,457 (GRCm39) missense probably benign 0.01
R0708:Dnah6 UTSW 6 73,189,605 (GRCm39) missense probably benign 0.05
R0711:Dnah6 UTSW 6 73,064,585 (GRCm39) missense probably damaging 0.99
R0718:Dnah6 UTSW 6 73,012,276 (GRCm39) missense possibly damaging 0.80
R0894:Dnah6 UTSW 6 73,101,740 (GRCm39) missense probably benign 0.00
R0972:Dnah6 UTSW 6 73,136,176 (GRCm39) missense possibly damaging 0.94
R1263:Dnah6 UTSW 6 73,121,948 (GRCm39) missense probably damaging 0.99
R1298:Dnah6 UTSW 6 73,136,118 (GRCm39) missense probably damaging 1.00
R1300:Dnah6 UTSW 6 73,101,692 (GRCm39) missense probably benign 0.22
R1301:Dnah6 UTSW 6 73,185,528 (GRCm39) critical splice donor site probably null
R1341:Dnah6 UTSW 6 73,168,602 (GRCm39) missense probably benign 0.09
R1509:Dnah6 UTSW 6 73,004,425 (GRCm39) missense probably damaging 1.00
R1519:Dnah6 UTSW 6 73,026,031 (GRCm39) missense probably damaging 0.97
R1533:Dnah6 UTSW 6 73,128,536 (GRCm39) missense probably benign
R1557:Dnah6 UTSW 6 73,026,114 (GRCm39) nonsense probably null
R1591:Dnah6 UTSW 6 73,053,583 (GRCm39) missense probably benign 0.01
R1602:Dnah6 UTSW 6 73,044,452 (GRCm39) missense probably damaging 1.00
R1610:Dnah6 UTSW 6 73,121,946 (GRCm39) missense probably benign 0.09
R1616:Dnah6 UTSW 6 73,077,095 (GRCm39) missense probably benign 0.10
R1643:Dnah6 UTSW 6 73,021,735 (GRCm39) missense possibly damaging 0.85
R1644:Dnah6 UTSW 6 73,132,279 (GRCm39) missense probably benign 0.18
R1655:Dnah6 UTSW 6 73,182,715 (GRCm39) missense possibly damaging 0.88
R1661:Dnah6 UTSW 6 73,101,761 (GRCm39) missense probably benign 0.00
R1665:Dnah6 UTSW 6 73,101,761 (GRCm39) missense probably benign 0.00
R1675:Dnah6 UTSW 6 73,106,523 (GRCm39) missense probably damaging 1.00
R1734:Dnah6 UTSW 6 73,021,744 (GRCm39) missense probably damaging 0.98
R1757:Dnah6 UTSW 6 73,137,965 (GRCm39) missense probably damaging 1.00
R1794:Dnah6 UTSW 6 73,001,941 (GRCm39) missense probably damaging 0.99
R1831:Dnah6 UTSW 6 73,158,780 (GRCm39) missense possibly damaging 0.76
R1866:Dnah6 UTSW 6 73,077,071 (GRCm39) missense probably benign 0.00
R1897:Dnah6 UTSW 6 73,158,745 (GRCm39) missense probably benign 0.30
R1951:Dnah6 UTSW 6 73,061,704 (GRCm39) nonsense probably null
R1978:Dnah6 UTSW 6 73,098,953 (GRCm39) missense possibly damaging 0.51
R1987:Dnah6 UTSW 6 73,072,027 (GRCm39) missense probably damaging 0.96
R1988:Dnah6 UTSW 6 73,069,175 (GRCm39) missense probably damaging 1.00
R2012:Dnah6 UTSW 6 73,044,449 (GRCm39) missense probably damaging 1.00
R2014:Dnah6 UTSW 6 73,150,402 (GRCm39) missense probably damaging 0.98
R2022:Dnah6 UTSW 6 73,004,405 (GRCm39) missense probably benign
R2041:Dnah6 UTSW 6 73,050,422 (GRCm39) missense probably damaging 1.00
R2068:Dnah6 UTSW 6 72,998,165 (GRCm39) missense probably benign 0.23
R2114:Dnah6 UTSW 6 73,121,018 (GRCm39) missense probably damaging 1.00
R2152:Dnah6 UTSW 6 73,026,149 (GRCm39) missense probably benign 0.32
R2163:Dnah6 UTSW 6 73,066,729 (GRCm39) splice site probably null
R2193:Dnah6 UTSW 6 73,115,623 (GRCm39) missense probably damaging 1.00
R2235:Dnah6 UTSW 6 73,077,068 (GRCm39) missense probably damaging 0.96
R2276:Dnah6 UTSW 6 73,090,564 (GRCm39) missense probably benign 0.15
R2292:Dnah6 UTSW 6 72,998,092 (GRCm39) missense probably damaging 1.00
R2355:Dnah6 UTSW 6 73,133,404 (GRCm39) missense possibly damaging 0.95
R2395:Dnah6 UTSW 6 73,068,950 (GRCm39) splice site probably null
R2436:Dnah6 UTSW 6 73,126,156 (GRCm39) missense probably benign 0.05
R2847:Dnah6 UTSW 6 73,106,314 (GRCm39) missense probably benign 0.41
R2848:Dnah6 UTSW 6 73,106,314 (GRCm39) missense probably benign 0.41
R3033:Dnah6 UTSW 6 73,150,333 (GRCm39) missense probably benign 0.03
R3429:Dnah6 UTSW 6 73,098,797 (GRCm39) missense possibly damaging 0.95
R3430:Dnah6 UTSW 6 73,098,797 (GRCm39) missense possibly damaging 0.95
R3499:Dnah6 UTSW 6 73,009,616 (GRCm39) missense probably benign 0.21
R3811:Dnah6 UTSW 6 73,168,481 (GRCm39) missense probably benign 0.00
R3975:Dnah6 UTSW 6 73,098,975 (GRCm39) missense possibly damaging 0.93
R4164:Dnah6 UTSW 6 73,066,575 (GRCm39) nonsense probably null
R4246:Dnah6 UTSW 6 73,106,431 (GRCm39) missense probably benign 0.00
R4367:Dnah6 UTSW 6 73,126,467 (GRCm39) missense possibly damaging 0.95
R4378:Dnah6 UTSW 6 73,095,009 (GRCm39) missense probably benign 0.01
R4405:Dnah6 UTSW 6 73,106,274 (GRCm39) missense probably benign 0.00
R4420:Dnah6 UTSW 6 73,168,462 (GRCm39) missense probably benign
R4486:Dnah6 UTSW 6 73,015,729 (GRCm39) missense probably damaging 1.00
R4512:Dnah6 UTSW 6 73,155,399 (GRCm39) missense probably damaging 1.00
R4547:Dnah6 UTSW 6 73,169,388 (GRCm39) missense probably benign
R4573:Dnah6 UTSW 6 73,063,164 (GRCm39) missense probably damaging 1.00
R4574:Dnah6 UTSW 6 73,063,164 (GRCm39) missense probably damaging 1.00
R4590:Dnah6 UTSW 6 73,129,695 (GRCm39) missense probably damaging 0.99
R4604:Dnah6 UTSW 6 73,106,643 (GRCm39) missense possibly damaging 0.92
R4652:Dnah6 UTSW 6 73,047,580 (GRCm39) missense probably benign
R4653:Dnah6 UTSW 6 73,050,440 (GRCm39) missense possibly damaging 0.76
R4669:Dnah6 UTSW 6 73,014,671 (GRCm39) missense probably damaging 1.00
R4674:Dnah6 UTSW 6 73,169,405 (GRCm39) missense probably benign 0.04
R4712:Dnah6 UTSW 6 73,001,995 (GRCm39) critical splice acceptor site probably null
R4788:Dnah6 UTSW 6 73,106,513 (GRCm39) missense probably damaging 1.00
R4791:Dnah6 UTSW 6 73,072,057 (GRCm39) missense probably benign 0.11
R4792:Dnah6 UTSW 6 73,066,651 (GRCm39) missense probably damaging 0.99
R4801:Dnah6 UTSW 6 73,066,681 (GRCm39) missense probably damaging 1.00
R4802:Dnah6 UTSW 6 73,066,681 (GRCm39) missense probably damaging 1.00
R4817:Dnah6 UTSW 6 72,999,407 (GRCm39) missense probably benign 0.02
R4830:Dnah6 UTSW 6 73,021,745 (GRCm39) missense possibly damaging 0.85
R4862:Dnah6 UTSW 6 73,098,771 (GRCm39) missense probably damaging 0.99
R4916:Dnah6 UTSW 6 73,169,659 (GRCm39) intron probably benign
R4948:Dnah6 UTSW 6 73,030,672 (GRCm39) missense probably benign 0.00
R4953:Dnah6 UTSW 6 73,165,366 (GRCm39) missense probably benign 0.19
R5000:Dnah6 UTSW 6 73,121,798 (GRCm39) missense probably benign 0.26
R5036:Dnah6 UTSW 6 73,021,674 (GRCm39) missense probably benign
R5044:Dnah6 UTSW 6 73,014,605 (GRCm39) missense probably benign 0.41
R5143:Dnah6 UTSW 6 73,158,744 (GRCm39) missense possibly damaging 0.91
R5157:Dnah6 UTSW 6 73,172,617 (GRCm39) missense probably benign
R5186:Dnah6 UTSW 6 73,044,410 (GRCm39) missense probably damaging 1.00
R5201:Dnah6 UTSW 6 73,172,715 (GRCm39) missense possibly damaging 0.82
R5249:Dnah6 UTSW 6 73,090,471 (GRCm39) missense probably damaging 1.00
R5272:Dnah6 UTSW 6 73,104,844 (GRCm39) critical splice donor site probably null
R5330:Dnah6 UTSW 6 73,051,573 (GRCm39) missense probably damaging 1.00
R5331:Dnah6 UTSW 6 73,051,573 (GRCm39) missense probably damaging 1.00
R5340:Dnah6 UTSW 6 73,189,603 (GRCm39) missense probably benign
R5343:Dnah6 UTSW 6 73,189,599 (GRCm39) missense probably benign
R5375:Dnah6 UTSW 6 73,100,838 (GRCm39) missense probably damaging 1.00
R5380:Dnah6 UTSW 6 73,014,598 (GRCm39) missense probably damaging 1.00
R5435:Dnah6 UTSW 6 73,037,121 (GRCm39) missense probably benign 0.00
R5455:Dnah6 UTSW 6 73,052,717 (GRCm39) missense probably benign 0.00
R5458:Dnah6 UTSW 6 73,063,168 (GRCm39) missense probably damaging 1.00
R5463:Dnah6 UTSW 6 73,069,140 (GRCm39) missense probably benign 0.04
R5484:Dnah6 UTSW 6 73,069,099 (GRCm39) missense possibly damaging 0.95
R5513:Dnah6 UTSW 6 73,167,402 (GRCm39) missense probably null 0.00
R5527:Dnah6 UTSW 6 73,136,212 (GRCm39) missense probably benign
R5541:Dnah6 UTSW 6 73,169,971 (GRCm39) missense possibly damaging 0.91
R5548:Dnah6 UTSW 6 73,128,672 (GRCm39) missense probably damaging 1.00
R5680:Dnah6 UTSW 6 73,126,508 (GRCm39) missense probably damaging 1.00
R5689:Dnah6 UTSW 6 72,998,210 (GRCm39) missense probably benign 0.12
R5966:Dnah6 UTSW 6 73,037,262 (GRCm39) missense probably benign 0.00
R5980:Dnah6 UTSW 6 73,158,705 (GRCm39) missense probably benign 0.01
R6049:Dnah6 UTSW 6 73,063,149 (GRCm39) missense probably benign 0.38
R6092:Dnah6 UTSW 6 73,091,680 (GRCm39) missense possibly damaging 0.61
R6130:Dnah6 UTSW 6 73,165,477 (GRCm39) missense probably benign 0.16
R6279:Dnah6 UTSW 6 73,042,798 (GRCm39) missense probably damaging 1.00
R6300:Dnah6 UTSW 6 73,042,798 (GRCm39) missense probably damaging 1.00
R6301:Dnah6 UTSW 6 73,063,200 (GRCm39) missense probably damaging 1.00
R6315:Dnah6 UTSW 6 73,168,588 (GRCm39) missense probably benign 0.02
R6394:Dnah6 UTSW 6 73,132,401 (GRCm39) nonsense probably null
R6470:Dnah6 UTSW 6 73,051,569 (GRCm39) missense probably damaging 1.00
R6526:Dnah6 UTSW 6 73,051,687 (GRCm39) missense probably benign 0.05
R6545:Dnah6 UTSW 6 73,021,715 (GRCm39) missense probably damaging 1.00
R6583:Dnah6 UTSW 6 73,150,516 (GRCm39) missense probably benign 0.02
R6609:Dnah6 UTSW 6 73,030,678 (GRCm39) missense possibly damaging 0.52
R6638:Dnah6 UTSW 6 73,012,263 (GRCm39) splice site probably null
R6640:Dnah6 UTSW 6 73,001,276 (GRCm39) missense probably damaging 1.00
R6647:Dnah6 UTSW 6 73,115,743 (GRCm39) missense probably damaging 1.00
R6744:Dnah6 UTSW 6 73,014,532 (GRCm39) missense probably damaging 0.97
R6767:Dnah6 UTSW 6 73,110,591 (GRCm39) missense probably benign 0.29
R6845:Dnah6 UTSW 6 73,110,525 (GRCm39) missense probably damaging 1.00
R6913:Dnah6 UTSW 6 73,189,505 (GRCm39) missense probably benign 0.00
R6918:Dnah6 UTSW 6 73,158,738 (GRCm39) nonsense probably null
R6929:Dnah6 UTSW 6 73,021,756 (GRCm39) missense probably damaging 0.96
R6981:Dnah6 UTSW 6 72,998,161 (GRCm39) missense probably benign 0.00
R7065:Dnah6 UTSW 6 73,064,545 (GRCm39) missense possibly damaging 0.87
R7139:Dnah6 UTSW 6 73,112,663 (GRCm39) missense probably damaging 1.00
R7169:Dnah6 UTSW 6 73,015,729 (GRCm39) missense probably damaging 1.00
R7202:Dnah6 UTSW 6 73,158,688 (GRCm39) critical splice donor site probably null
R7203:Dnah6 UTSW 6 73,150,528 (GRCm39) missense probably benign 0.00
R7315:Dnah6 UTSW 6 73,061,743 (GRCm39) missense probably damaging 1.00
R7329:Dnah6 UTSW 6 73,121,705 (GRCm39) nonsense probably null
R7387:Dnah6 UTSW 6 73,189,595 (GRCm39) nonsense probably null
R7388:Dnah6 UTSW 6 73,169,300 (GRCm39) missense possibly damaging 0.47
R7454:Dnah6 UTSW 6 73,189,475 (GRCm39) missense probably damaging 1.00
R7520:Dnah6 UTSW 6 73,104,887 (GRCm39) missense probably benign 0.04
R7524:Dnah6 UTSW 6 73,095,082 (GRCm39) missense probably damaging 1.00
R7548:Dnah6 UTSW 6 73,004,423 (GRCm39) missense probably damaging 1.00
R7570:Dnah6 UTSW 6 73,126,413 (GRCm39) missense probably benign 0.01
R7604:Dnah6 UTSW 6 73,069,151 (GRCm39) missense probably damaging 1.00
R7615:Dnah6 UTSW 6 73,072,189 (GRCm39) missense possibly damaging 0.85
R7622:Dnah6 UTSW 6 73,101,742 (GRCm39) missense possibly damaging 0.94
R7690:Dnah6 UTSW 6 73,146,063 (GRCm39) splice site probably null
R7735:Dnah6 UTSW 6 73,046,412 (GRCm39) missense probably damaging 1.00
R7754:Dnah6 UTSW 6 73,002,703 (GRCm39) missense probably benign 0.41
R7829:Dnah6 UTSW 6 73,104,902 (GRCm39) nonsense probably null
R7904:Dnah6 UTSW 6 73,112,450 (GRCm39) splice site probably null
R8034:Dnah6 UTSW 6 73,106,208 (GRCm39) missense probably damaging 1.00
R8093:Dnah6 UTSW 6 73,137,896 (GRCm39) missense probably damaging 1.00
R8120:Dnah6 UTSW 6 73,002,769 (GRCm39) missense probably damaging 1.00
R8178:Dnah6 UTSW 6 73,037,208 (GRCm39) missense probably benign 0.16
R8206:Dnah6 UTSW 6 73,014,549 (GRCm39) nonsense probably null
R8214:Dnah6 UTSW 6 73,021,711 (GRCm39) missense probably damaging 1.00
R8269:Dnah6 UTSW 6 73,145,810 (GRCm39) critical splice donor site probably null
R8273:Dnah6 UTSW 6 73,172,664 (GRCm39) missense probably benign 0.00
R8273:Dnah6 UTSW 6 73,053,582 (GRCm39) missense probably benign 0.31
R8331:Dnah6 UTSW 6 73,001,983 (GRCm39) missense probably benign 0.10
R8350:Dnah6 UTSW 6 73,172,798 (GRCm39) missense probably benign 0.41
R8428:Dnah6 UTSW 6 73,051,634 (GRCm39) missense probably benign 0.15
R8447:Dnah6 UTSW 6 73,115,757 (GRCm39) missense probably damaging 0.99
R8450:Dnah6 UTSW 6 73,172,798 (GRCm39) missense probably benign 0.41
R8517:Dnah6 UTSW 6 73,155,440 (GRCm39) missense probably benign 0.16
R8523:Dnah6 UTSW 6 73,072,171 (GRCm39) missense probably damaging 1.00
R8691:Dnah6 UTSW 6 73,145,850 (GRCm39) missense probably damaging 1.00
R8700:Dnah6 UTSW 6 73,052,873 (GRCm39) intron probably benign
R8737:Dnah6 UTSW 6 73,044,428 (GRCm39) missense possibly damaging 0.83
R8762:Dnah6 UTSW 6 73,156,811 (GRCm39) missense possibly damaging 0.83
R8804:Dnah6 UTSW 6 73,042,756 (GRCm39) missense probably benign
R8809:Dnah6 UTSW 6 73,009,546 (GRCm39) missense possibly damaging 0.94
R8813:Dnah6 UTSW 6 73,104,937 (GRCm39) missense probably damaging 1.00
R8849:Dnah6 UTSW 6 73,121,156 (GRCm39) critical splice acceptor site probably null
R8867:Dnah6 UTSW 6 72,998,131 (GRCm39) missense probably damaging 1.00
R8882:Dnah6 UTSW 6 73,155,481 (GRCm39) missense probably benign 0.05
R8973:Dnah6 UTSW 6 73,121,734 (GRCm39) missense probably benign 0.39
R9049:Dnah6 UTSW 6 73,119,275 (GRCm39) missense probably damaging 1.00
R9053:Dnah6 UTSW 6 73,061,640 (GRCm39) missense possibly damaging 0.94
R9064:Dnah6 UTSW 6 73,126,156 (GRCm39) missense probably benign 0.00
R9077:Dnah6 UTSW 6 73,121,029 (GRCm39) nonsense probably null
R9102:Dnah6 UTSW 6 73,044,469 (GRCm39) missense probably benign
R9106:Dnah6 UTSW 6 73,121,752 (GRCm39) missense probably damaging 1.00
R9119:Dnah6 UTSW 6 73,037,186 (GRCm39) missense possibly damaging 0.95
R9124:Dnah6 UTSW 6 73,098,882 (GRCm39) missense possibly damaging 0.78
R9165:Dnah6 UTSW 6 73,121,924 (GRCm39) missense probably damaging 1.00
R9182:Dnah6 UTSW 6 73,121,688 (GRCm39) nonsense probably null
R9200:Dnah6 UTSW 6 73,004,497 (GRCm39) missense probably benign 0.06
R9265:Dnah6 UTSW 6 73,060,040 (GRCm39) missense probably benign 0.02
R9368:Dnah6 UTSW 6 72,998,261 (GRCm39) missense probably benign 0.22
R9378:Dnah6 UTSW 6 73,189,513 (GRCm39) missense probably benign
R9439:Dnah6 UTSW 6 73,012,330 (GRCm39) missense possibly damaging 0.66
R9506:Dnah6 UTSW 6 73,119,299 (GRCm39) missense probably damaging 1.00
R9645:Dnah6 UTSW 6 73,115,750 (GRCm39) missense possibly damaging 0.82
R9731:Dnah6 UTSW 6 73,168,589 (GRCm39) missense probably benign 0.00
RF002:Dnah6 UTSW 6 73,078,872 (GRCm39) missense probably benign
RF020:Dnah6 UTSW 6 73,095,040 (GRCm39) missense probably benign 0.00
W0251:Dnah6 UTSW 6 73,155,501 (GRCm39) missense possibly damaging 0.95
X0025:Dnah6 UTSW 6 73,168,483 (GRCm39) missense probably benign 0.01
X0025:Dnah6 UTSW 6 73,014,656 (GRCm39) missense probably damaging 1.00
Z1176:Dnah6 UTSW 6 73,110,542 (GRCm39) missense probably benign
Z1176:Dnah6 UTSW 6 73,064,766 (GRCm39) missense possibly damaging 0.79
Z1177:Dnah6 UTSW 6 73,009,509 (GRCm39) missense probably damaging 0.99
Z1177:Dnah6 UTSW 6 72,998,220 (GRCm39) missense probably benign 0.13
Z1177:Dnah6 UTSW 6 73,132,255 (GRCm39) missense possibly damaging 0.92
Z1177:Dnah6 UTSW 6 73,018,121 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAAGCACGGCATTCCTCT -3'
(R):5'- TCCCTTTCCATGTTAGATCACAC -3'

Sequencing Primer
(F):5'- GAAAGCACGGCATTCCTCTAATCTC -3'
(R):5'- CTACAGAGTGGGTTTCAGGAC -3'
Posted On 2015-04-06