Incidental Mutation 'R3852:Vmn1r60'
ID275969
Institutional Source Beutler Lab
Gene Symbol Vmn1r60
Ensembl Gene ENSMUSG00000090794
Gene Namevomeronasal 1 receptor 60
SynonymsGm7184
MMRRC Submission 040784-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3852 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location5544172-5545178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5545027 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 25 (F25I)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173782]
Predicted Effect possibly damaging
Transcript: ENSMUST00000172111
AA Change: F25I

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133113
Gene: ENSMUSG00000090794
AA Change: F25I

DomainStartEndE-ValueType
Pfam:TAS2R 1 294 1.1e-10 PFAM
Pfam:7tm_1 20 280 7.3e-12 PFAM
Pfam:V1R 31 299 1.3e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173782
AA Change: F25I

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133943
Gene: ENSMUSG00000090794
AA Change: F25I

DomainStartEndE-ValueType
Pfam:TAS2R 8 304 4.7e-10 PFAM
Pfam:7tm_1 30 289 7.2e-6 PFAM
Pfam:V1R 41 309 1.8e-17 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T C 16: 20,560,439 V685A probably damaging Het
Abhd4 T C 14: 54,265,367 Y44H probably damaging Het
AI429214 A G 8: 36,994,442 D248G probably damaging Het
AY358078 A G 14: 51,805,553 T233A unknown Het
Calcr T C 6: 3,693,735 Y353C probably damaging Het
Ccdc34 A G 2: 110,032,428 K193E possibly damaging Het
Dhcr24 A G 4: 106,573,873 E253G probably benign Het
Dnah6 A G 6: 73,127,927 V1841A possibly damaging Het
Dpp10 A T 1: 123,485,924 Y186* probably null Het
Dpysl4 C T 7: 139,100,935 T575M probably damaging Het
Dusp7 T A 9: 106,373,893 S406T probably benign Het
Gga3 T A 11: 115,587,542 T475S probably benign Het
Gm10271 T A 10: 116,956,874 K36* probably null Het
Gm572 G A 4: 148,668,872 E325K possibly damaging Het
Golga2 A G 2: 32,305,611 E806G probably benign Het
Igf1 A T 10: 87,915,319 K126* probably null Het
Itpkc A T 7: 27,227,612 N292K probably benign Het
Klhl1 A T 14: 96,280,205 M345K probably benign Het
Lrp2 A G 2: 69,537,565 V201A probably damaging Het
Lrrc8a C T 2: 30,261,960 T757M probably benign Het
Mios T A 6: 8,216,453 I459K probably benign Het
Mrps11 T C 7: 78,790,645 I94T probably damaging Het
Ms4a4c T A 19: 11,416,395 S68T probably benign Het
Mstn C T 1: 53,061,971 T69I possibly damaging Het
Myo10 A G 15: 25,779,626 K28E probably damaging Het
Nol6 A G 4: 41,117,452 S914P probably damaging Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr547 C A 7: 102,535,280 H178N probably benign Het
Olfr585 T C 7: 103,098,184 S148P probably damaging Het
Pcdh17 C T 14: 84,447,259 Q389* probably null Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Prr14l T C 5: 32,830,345 E602G probably damaging Het
Rusc2 C A 4: 43,416,424 Q577K probably benign Het
Sacm1l T A 9: 123,587,576 M534K probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco4a1 C T 2: 180,464,091 T22M probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tas2r104 A T 6: 131,684,925 C274S probably benign Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trim43c T A 9: 88,840,401 H33Q probably damaging Het
Ttc17 A T 2: 94,369,413 I411K possibly damaging Het
Ttn G T 2: 76,751,334 L23072I possibly damaging Het
Ttn A C 2: 76,955,024 V669G possibly damaging Het
Vmn2r9 A G 5: 108,848,131 I217T probably damaging Het
Other mutations in Vmn1r60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01869:Vmn1r60 APN 7 5544229 missense probably benign 0.05
IGL01892:Vmn1r60 APN 7 5544310 missense probably benign 0.02
IGL02427:Vmn1r60 APN 7 5544781 missense probably damaging 1.00
IGL03071:Vmn1r60 APN 7 5544369 missense probably damaging 0.97
R0200:Vmn1r60 UTSW 7 5544380 missense probably benign
R0457:Vmn1r60 UTSW 7 5545119 start gained probably benign
R1175:Vmn1r60 UTSW 7 5544622 missense probably benign 0.01
R1199:Vmn1r60 UTSW 7 5544972 missense probably damaging 0.99
R1529:Vmn1r60 UTSW 7 5544903 missense probably benign 0.00
R1859:Vmn1r60 UTSW 7 5544550 missense possibly damaging 0.64
R2033:Vmn1r60 UTSW 7 5544820 missense probably benign
R2405:Vmn1r60 UTSW 7 5544913 missense probably benign
R3408:Vmn1r60 UTSW 7 5545149 utr 5 prime probably null
R3771:Vmn1r60 UTSW 7 5544711 missense possibly damaging 0.76
R3773:Vmn1r60 UTSW 7 5544711 missense possibly damaging 0.76
R4236:Vmn1r60 UTSW 7 5544804 missense probably benign 0.06
R4331:Vmn1r60 UTSW 7 5544365 nonsense probably null
R4439:Vmn1r60 UTSW 7 5544489 missense probably damaging 1.00
R5099:Vmn1r60 UTSW 7 5544817 missense probably damaging 0.98
R5325:Vmn1r60 UTSW 7 5544202 missense probably benign
R5415:Vmn1r60 UTSW 7 5544417 missense probably benign 0.38
R5818:Vmn1r60 UTSW 7 5545099 start codon destroyed probably benign 0.04
R6375:Vmn1r60 UTSW 7 5545018 missense probably damaging 0.96
R6378:Vmn1r60 UTSW 7 5544783 missense probably damaging 0.99
R6478:Vmn1r60 UTSW 7 5544865 missense probably damaging 1.00
R6572:Vmn1r60 UTSW 7 5544600 missense probably benign 0.40
R6586:Vmn1r60 UTSW 7 5544447 missense probably benign 0.00
R7061:Vmn1r60 UTSW 7 5544311 nonsense probably null
R7506:Vmn1r60 UTSW 7 5544862 missense
R7589:Vmn1r60 UTSW 7 5544689 missense
Predicted Primers PCR Primer
(F):5'- GCAAGTTTACATTTGAGGTCAGTTG -3'
(R):5'- AGTGTGTCAAAGCAGTGGC -3'

Sequencing Primer
(F):5'- TGGAGGCTTCCTGGGAACAATATC -3'
(R):5'- GACACAAAACCTCCAAAACAATTG -3'
Posted On2015-04-06