Incidental Mutation 'R3852:Itpkc'
ID275970
Institutional Source Beutler Lab
Gene Symbol Itpkc
Ensembl Gene ENSMUSG00000003752
Gene Nameinositol 1,4,5-trisphosphate 3-kinase C
Synonyms
MMRRC Submission 040784-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.621) question?
Stock #R3852 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location27207172-27228661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27227612 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 292 (N292K)
Ref Sequence ENSEMBL: ENSMUSP00000003850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003850]
Predicted Effect probably benign
Transcript: ENSMUST00000003850
AA Change: N292K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000003850
Gene: ENSMUSG00000003752
AA Change: N292K

DomainStartEndE-ValueType
low complexity region 28 59 N/A INTRINSIC
low complexity region 346 363 N/A INTRINSIC
Pfam:IPK 462 673 3.7e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206441
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inositol 1,4,5-trisphosphate [Ins(1,4,5)P(3)] 3-kinase family of enzymes that catalyze the phosphorylation of inositol 1,4,5-trisphosphate to 1,3,4,5-tetrakisphosphate. The encoded protein is localized to the nucleus and cytoplasm and has both nuclear import and nuclear export activity. Single nucleotide polymorphisms in this gene are associated with Kawasaki disease.[provided by RefSeq, Sep 2009]
PHENOTYPE: No overt phenotype reported. Thymocyte development was normal in homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T C 16: 20,560,439 V685A probably damaging Het
Abhd4 T C 14: 54,265,367 Y44H probably damaging Het
AI429214 A G 8: 36,994,442 D248G probably damaging Het
AY358078 A G 14: 51,805,553 T233A unknown Het
Calcr T C 6: 3,693,735 Y353C probably damaging Het
Ccdc34 A G 2: 110,032,428 K193E possibly damaging Het
Dhcr24 A G 4: 106,573,873 E253G probably benign Het
Dnah6 A G 6: 73,127,927 V1841A possibly damaging Het
Dpp10 A T 1: 123,485,924 Y186* probably null Het
Dpysl4 C T 7: 139,100,935 T575M probably damaging Het
Dusp7 T A 9: 106,373,893 S406T probably benign Het
Gga3 T A 11: 115,587,542 T475S probably benign Het
Gm10271 T A 10: 116,956,874 K36* probably null Het
Gm572 G A 4: 148,668,872 E325K possibly damaging Het
Golga2 A G 2: 32,305,611 E806G probably benign Het
Igf1 A T 10: 87,915,319 K126* probably null Het
Klhl1 A T 14: 96,280,205 M345K probably benign Het
Lrp2 A G 2: 69,537,565 V201A probably damaging Het
Lrrc8a C T 2: 30,261,960 T757M probably benign Het
Mios T A 6: 8,216,453 I459K probably benign Het
Mrps11 T C 7: 78,790,645 I94T probably damaging Het
Ms4a4c T A 19: 11,416,395 S68T probably benign Het
Mstn C T 1: 53,061,971 T69I possibly damaging Het
Myo10 A G 15: 25,779,626 K28E probably damaging Het
Nol6 A G 4: 41,117,452 S914P probably damaging Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr547 C A 7: 102,535,280 H178N probably benign Het
Olfr585 T C 7: 103,098,184 S148P probably damaging Het
Pcdh17 C T 14: 84,447,259 Q389* probably null Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Prr14l T C 5: 32,830,345 E602G probably damaging Het
Rusc2 C A 4: 43,416,424 Q577K probably benign Het
Sacm1l T A 9: 123,587,576 M534K probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco4a1 C T 2: 180,464,091 T22M probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tas2r104 A T 6: 131,684,925 C274S probably benign Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trim43c T A 9: 88,840,401 H33Q probably damaging Het
Ttc17 A T 2: 94,369,413 I411K possibly damaging Het
Ttn G T 2: 76,751,334 L23072I possibly damaging Het
Ttn A C 2: 76,955,024 V669G possibly damaging Het
Vmn1r60 A T 7: 5,545,027 F25I possibly damaging Het
Vmn2r9 A G 5: 108,848,131 I217T probably damaging Het
Other mutations in Itpkc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01751:Itpkc APN 7 27213066 unclassified probably benign
IGL01774:Itpkc APN 7 27212370 missense probably benign 0.05
IGL02134:Itpkc APN 7 27227875 nonsense probably null
IGL02719:Itpkc APN 7 27228050 missense possibly damaging 0.92
R0284:Itpkc UTSW 7 27214543 nonsense probably null
R0364:Itpkc UTSW 7 27227749 missense possibly damaging 0.80
R0403:Itpkc UTSW 7 27208345 missense probably benign 0.01
R1175:Itpkc UTSW 7 27227770 missense probably benign 0.00
R1676:Itpkc UTSW 7 27208281 missense probably damaging 1.00
R1813:Itpkc UTSW 7 27208380 missense probably damaging 1.00
R1896:Itpkc UTSW 7 27208380 missense probably damaging 1.00
R1944:Itpkc UTSW 7 27227659 missense possibly damaging 0.55
R2142:Itpkc UTSW 7 27219650 missense possibly damaging 0.83
R3030:Itpkc UTSW 7 27212308 splice site probably null
R3738:Itpkc UTSW 7 27227604 missense possibly damaging 0.95
R3739:Itpkc UTSW 7 27227604 missense possibly damaging 0.95
R3754:Itpkc UTSW 7 27228432 missense probably damaging 1.00
R3851:Itpkc UTSW 7 27227612 missense probably benign 0.00
R3916:Itpkc UTSW 7 27228303 missense probably benign 0.09
R3963:Itpkc UTSW 7 27227509 missense probably damaging 1.00
R5770:Itpkc UTSW 7 27212988 missense probably damaging 1.00
R5943:Itpkc UTSW 7 27212979 missense possibly damaging 0.69
R6012:Itpkc UTSW 7 27228065 missense probably damaging 0.98
R6835:Itpkc UTSW 7 27227815 missense probably benign 0.02
R7107:Itpkc UTSW 7 27228277 missense probably benign 0.15
R7379:Itpkc UTSW 7 27227769 missense probably benign 0.12
Z1176:Itpkc UTSW 7 27227638 missense probably benign 0.01
Z1177:Itpkc UTSW 7 27227781 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTCAGATTCATCAAAAGAGGAGGC -3'
(R):5'- ATGCTTCCAGGACTCCACATG -3'

Sequencing Primer
(F):5'- AAGAGAAGCCGCCAGTGCC -3'
(R):5'- ACATGACACCGACGGCTTCTG -3'
Posted On2015-04-06