Incidental Mutation 'R3852:Mrps11'
ID275971
Institutional Source Beutler Lab
Gene Symbol Mrps11
Ensembl Gene ENSMUSG00000030611
Gene Namemitochondrial ribosomal protein S11
Synonyms
MMRRC Submission 040784-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R3852 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location78783119-78792989 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78790645 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 94 (I94T)
Ref Sequence ENSEMBL: ENSMUSP00000032840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032840] [ENSMUST00000133553]
Predicted Effect probably damaging
Transcript: ENSMUST00000032840
AA Change: I94T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032840
Gene: ENSMUSG00000030611
AA Change: I94T

DomainStartEndE-ValueType
Pfam:Ribosomal_S11 81 190 1.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133304
Predicted Effect probably benign
Transcript: ENSMUST00000133553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136001
Meta Mutation Damage Score 0.9077 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that contains a high level of sequence similarity with ribosomal protein S11P family members. A pseudogene corresponding to this gene is found on chromosome 20. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T C 16: 20,560,439 V685A probably damaging Het
Abhd4 T C 14: 54,265,367 Y44H probably damaging Het
AI429214 A G 8: 36,994,442 D248G probably damaging Het
AY358078 A G 14: 51,805,553 T233A unknown Het
Calcr T C 6: 3,693,735 Y353C probably damaging Het
Ccdc34 A G 2: 110,032,428 K193E possibly damaging Het
Dhcr24 A G 4: 106,573,873 E253G probably benign Het
Dnah6 A G 6: 73,127,927 V1841A possibly damaging Het
Dpp10 A T 1: 123,485,924 Y186* probably null Het
Dpysl4 C T 7: 139,100,935 T575M probably damaging Het
Dusp7 T A 9: 106,373,893 S406T probably benign Het
Gga3 T A 11: 115,587,542 T475S probably benign Het
Gm10271 T A 10: 116,956,874 K36* probably null Het
Gm572 G A 4: 148,668,872 E325K possibly damaging Het
Golga2 A G 2: 32,305,611 E806G probably benign Het
Igf1 A T 10: 87,915,319 K126* probably null Het
Itpkc A T 7: 27,227,612 N292K probably benign Het
Klhl1 A T 14: 96,280,205 M345K probably benign Het
Lrp2 A G 2: 69,537,565 V201A probably damaging Het
Lrrc8a C T 2: 30,261,960 T757M probably benign Het
Mios T A 6: 8,216,453 I459K probably benign Het
Ms4a4c T A 19: 11,416,395 S68T probably benign Het
Mstn C T 1: 53,061,971 T69I possibly damaging Het
Myo10 A G 15: 25,779,626 K28E probably damaging Het
Nol6 A G 4: 41,117,452 S914P probably damaging Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr547 C A 7: 102,535,280 H178N probably benign Het
Olfr585 T C 7: 103,098,184 S148P probably damaging Het
Pcdh17 C T 14: 84,447,259 Q389* probably null Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Prr14l T C 5: 32,830,345 E602G probably damaging Het
Rusc2 C A 4: 43,416,424 Q577K probably benign Het
Sacm1l T A 9: 123,587,576 M534K probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco4a1 C T 2: 180,464,091 T22M probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tas2r104 A T 6: 131,684,925 C274S probably benign Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trim43c T A 9: 88,840,401 H33Q probably damaging Het
Ttc17 A T 2: 94,369,413 I411K possibly damaging Het
Ttn G T 2: 76,751,334 L23072I possibly damaging Het
Ttn A C 2: 76,955,024 V669G possibly damaging Het
Vmn1r60 A T 7: 5,545,027 F25I possibly damaging Het
Vmn2r9 A G 5: 108,848,131 I217T probably damaging Het
Other mutations in Mrps11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02642:Mrps11 APN 7 78788774 critical splice donor site probably null
IGL03325:Mrps11 APN 7 78790705 missense probably damaging 1.00
R0831:Mrps11 UTSW 7 78791863 splice site probably benign
R1432:Mrps11 UTSW 7 78783562 splice site probably benign
R1733:Mrps11 UTSW 7 78792712 missense probably damaging 1.00
R2909:Mrps11 UTSW 7 78788749 missense probably damaging 1.00
R4623:Mrps11 UTSW 7 78791941 critical splice donor site probably null
R5685:Mrps11 UTSW 7 78791880 missense probably benign 0.06
R5752:Mrps11 UTSW 7 78783595 missense probably benign 0.05
R6091:Mrps11 UTSW 7 78788718 missense possibly damaging 0.87
R8184:Mrps11 UTSW 7 78783377 missense possibly damaging 0.65
R8762:Mrps11 UTSW 7 78788739 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AAGTGGTTCCTTCGGGTGAC -3'
(R):5'- CTGGTTTAATGAGACTTCCCCAC -3'

Sequencing Primer
(F):5'- CTGTTGGGTGACGCTCTCC -3'
(R):5'- TTAATGAGACTTCCCCACTGTAAGC -3'
Posted On2015-04-06