Incidental Mutation 'R3852:Or51f1e'
ID 275973
Institutional Source Beutler Lab
Gene Symbol Or51f1e
Ensembl Gene ENSMUSG00000078080
Gene Name olfactory receptor family 51 subfamily F member 1E
Synonyms Olfr585, GA_x6K02T2PBJ9-5809085-5810035, MOR14-4
MMRRC Submission 040784-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R3852 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 102746950-102747906 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102747391 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 148 (S148P)
Ref Sequence ENSEMBL: ENSMUSP00000100476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104881]
AlphaFold E9PXW4
Predicted Effect probably damaging
Transcript: ENSMUST00000104881
AA Change: S148P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100476
Gene: ENSMUSG00000078080
AA Change: S148P

DomainStartEndE-ValueType
Pfam:7tm_4 40 318 1.3e-109 PFAM
Pfam:7TM_GPCR_Srsx 45 315 5.9e-6 PFAM
Pfam:7tm_1 50 300 7.9e-23 PFAM
Meta Mutation Damage Score 0.1130 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T C 16: 20,379,189 (GRCm39) V685A probably damaging Het
Abhd4 T C 14: 54,502,824 (GRCm39) Y44H probably damaging Het
AI429214 A G 8: 37,461,596 (GRCm39) D248G probably damaging Het
Aoc1l3 C T 6: 48,964,928 (GRCm39) P312L possibly damaging Het
AY358078 A G 14: 52,043,010 (GRCm39) T233A unknown Het
Calcr T C 6: 3,693,735 (GRCm39) Y353C probably damaging Het
Ccdc34 A G 2: 109,862,773 (GRCm39) K193E possibly damaging Het
Dhcr24 A G 4: 106,431,070 (GRCm39) E253G probably benign Het
Dnah6 A G 6: 73,104,910 (GRCm39) V1841A possibly damaging Het
Dpp10 A T 1: 123,413,653 (GRCm39) Y186* probably null Het
Dpysl4 C T 7: 138,680,851 (GRCm39) T575M probably damaging Het
Dusp7 T A 9: 106,251,092 (GRCm39) S406T probably benign Het
Gga3 T A 11: 115,478,368 (GRCm39) T475S probably benign Het
Gm10271 T A 10: 116,792,779 (GRCm39) K36* probably null Het
Gm572 G A 4: 148,753,329 (GRCm39) E325K possibly damaging Het
Golga2 A G 2: 32,195,623 (GRCm39) E806G probably benign Het
Igf1 A T 10: 87,751,181 (GRCm39) K126* probably null Het
Itpkc A T 7: 26,927,037 (GRCm39) N292K probably benign Het
Klhl1 A T 14: 96,517,641 (GRCm39) M345K probably benign Het
Lrp2 A G 2: 69,367,909 (GRCm39) V201A probably damaging Het
Lrrc8a C T 2: 30,151,972 (GRCm39) T757M probably benign Het
Mios T A 6: 8,216,453 (GRCm39) I459K probably benign Het
Mrps11 T C 7: 78,440,393 (GRCm39) I94T probably damaging Het
Ms4a4c T A 19: 11,393,759 (GRCm39) S68T probably benign Het
Mstn C T 1: 53,101,130 (GRCm39) T69I possibly damaging Het
Myo10 A G 15: 25,779,712 (GRCm39) K28E probably damaging Het
Nol6 A G 4: 41,117,452 (GRCm39) S914P probably damaging Het
Ntn1 C G 11: 68,276,619 (GRCm39) D110H probably damaging Het
Or52b4 C A 7: 102,184,487 (GRCm39) H178N probably benign Het
Pcdh17 C T 14: 84,684,699 (GRCm39) Q389* probably null Het
Pik3r2 G A 8: 71,223,065 (GRCm39) R452C probably benign Het
Prr14l T C 5: 32,987,689 (GRCm39) E602G probably damaging Het
Rusc2 C A 4: 43,416,424 (GRCm39) Q577K probably benign Het
Sacm1l T A 9: 123,416,641 (GRCm39) M534K probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slco4a1 C T 2: 180,105,884 (GRCm39) T22M probably benign Het
Tas2r104 A T 6: 131,661,888 (GRCm39) C274S probably benign Het
Tnrc6c C T 11: 117,614,355 (GRCm39) R838W probably damaging Het
Trim43c T A 9: 88,722,454 (GRCm39) H33Q probably damaging Het
Ttc17 A T 2: 94,199,758 (GRCm39) I411K possibly damaging Het
Ttn G T 2: 76,581,678 (GRCm39) L23072I possibly damaging Het
Ttn A C 2: 76,785,368 (GRCm39) V669G possibly damaging Het
Vmn1r60 A T 7: 5,548,026 (GRCm39) F25I possibly damaging Het
Vmn2r9 A G 5: 108,995,997 (GRCm39) I217T probably damaging Het
Other mutations in Or51f1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Or51f1e APN 7 102,747,077 (GRCm39) missense probably damaging 1.00
IGL02866:Or51f1e APN 7 102,747,590 (GRCm39) missense probably damaging 0.99
FR4548:Or51f1e UTSW 7 102,747,516 (GRCm39) nonsense probably null
FR4976:Or51f1e UTSW 7 102,747,516 (GRCm39) small insertion probably benign
R0893:Or51f1e UTSW 7 102,747,641 (GRCm39) missense probably benign 0.01
R0926:Or51f1e UTSW 7 102,747,092 (GRCm39) missense probably damaging 1.00
R1486:Or51f1e UTSW 7 102,747,637 (GRCm39) missense probably damaging 1.00
R2031:Or51f1e UTSW 7 102,747,371 (GRCm39) missense probably damaging 0.98
R4849:Or51f1e UTSW 7 102,747,526 (GRCm39) missense possibly damaging 0.95
R5241:Or51f1e UTSW 7 102,747,524 (GRCm39) missense probably benign 0.36
R5668:Or51f1e UTSW 7 102,747,103 (GRCm39) missense probably benign 0.42
R5841:Or51f1e UTSW 7 102,747,161 (GRCm39) missense probably damaging 1.00
R6902:Or51f1e UTSW 7 102,747,562 (GRCm39) missense probably benign 0.12
R7943:Or51f1e UTSW 7 102,747,153 (GRCm39) missense probably damaging 0.98
R8265:Or51f1e UTSW 7 102,747,304 (GRCm39) missense probably benign 0.00
R8969:Or51f1e UTSW 7 102,747,251 (GRCm39) missense probably damaging 0.99
R9345:Or51f1e UTSW 7 102,747,713 (GRCm39) missense possibly damaging 0.93
R9376:Or51f1e UTSW 7 102,746,971 (GRCm39) missense probably benign 0.01
R9702:Or51f1e UTSW 7 102,747,343 (GRCm39) missense probably damaging 0.99
RF003:Or51f1e UTSW 7 102,747,513 (GRCm39) nonsense probably null
RF003:Or51f1e UTSW 7 102,747,512 (GRCm39)
RF004:Or51f1e UTSW 7 102,747,516 (GRCm39) nonsense probably null
RF004:Or51f1e UTSW 7 102,747,515 (GRCm39) small insertion probably benign
RF004:Or51f1e UTSW 7 102,747,512 (GRCm39)
Predicted Primers PCR Primer
(F):5'- CCTTGAGAATCCTGTGGTTTCAG -3'
(R):5'- ACAATGCAGGGAATATCTAGCCC -3'

Sequencing Primer
(F):5'- CCTGTGGTTTCAGGCAAATG -3'
(R):5'- TAGCCCTGTCGTCAGAATGAGATC -3'
Posted On 2015-04-06