Incidental Mutation 'R3852:Pik3r2'
ID275977
Institutional Source Beutler Lab
Gene Symbol Pik3r2
Ensembl Gene ENSMUSG00000031834
Gene Namephosphoinositide-3-kinase regulatory subunit 2
Synonymsp85beta
MMRRC Submission 040784-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3852 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70768176-70776713 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70770421 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 452 (R452C)
Ref Sequence ENSEMBL: ENSMUSP00000034296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000143785]
PDB Structure
CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000034296
AA Change: R452C

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834
AA Change: R452C

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000034299
SMART Domains Protein: ENSMUSP00000034299
Gene: ENSMUSG00000031838

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:GILT 60 163 4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142370
Predicted Effect probably benign
Transcript: ENSMUST00000143785
SMART Domains Protein: ENSMUSP00000122065
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
Blast:RhoGAP 1 30 1e-8 BLAST
Pfam:SH2 33 70 4.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146707
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152545
Predicted Effect probably benign
Transcript: ENSMUST00000154685
SMART Domains Protein: ENSMUSP00000121463
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
PDB:2XS6|A 43 84 3e-11 PDB
SCOP:d1pbwa_ 47 79 6e-9 SMART
Blast:RhoGAP 58 84 4e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222087
Meta Mutation Damage Score 0.4834 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase (PI3K) is a lipid kinase that phosphorylates phosphatidylinositol and similar compounds, creating second messengers important in growth signaling pathways. PI3K functions as a heterodimer of a regulatory and a catalytic subunit. The protein encoded by this gene is a regulatory component of PI3K. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene have lower blood glucose levels both when fed and after fasting. Insulin sensitivity is improved as well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T C 16: 20,560,439 V685A probably damaging Het
Abhd4 T C 14: 54,265,367 Y44H probably damaging Het
AI429214 A G 8: 36,994,442 D248G probably damaging Het
AY358078 A G 14: 51,805,553 T233A unknown Het
Calcr T C 6: 3,693,735 Y353C probably damaging Het
Ccdc34 A G 2: 110,032,428 K193E possibly damaging Het
Dhcr24 A G 4: 106,573,873 E253G probably benign Het
Dnah6 A G 6: 73,127,927 V1841A possibly damaging Het
Dpp10 A T 1: 123,485,924 Y186* probably null Het
Dpysl4 C T 7: 139,100,935 T575M probably damaging Het
Dusp7 T A 9: 106,373,893 S406T probably benign Het
Gga3 T A 11: 115,587,542 T475S probably benign Het
Gm10271 T A 10: 116,956,874 K36* probably null Het
Gm572 G A 4: 148,668,872 E325K possibly damaging Het
Golga2 A G 2: 32,305,611 E806G probably benign Het
Igf1 A T 10: 87,915,319 K126* probably null Het
Itpkc A T 7: 27,227,612 N292K probably benign Het
Klhl1 A T 14: 96,280,205 M345K probably benign Het
Lrp2 A G 2: 69,537,565 V201A probably damaging Het
Lrrc8a C T 2: 30,261,960 T757M probably benign Het
Mios T A 6: 8,216,453 I459K probably benign Het
Mrps11 T C 7: 78,790,645 I94T probably damaging Het
Ms4a4c T A 19: 11,416,395 S68T probably benign Het
Mstn C T 1: 53,061,971 T69I possibly damaging Het
Myo10 A G 15: 25,779,626 K28E probably damaging Het
Nol6 A G 4: 41,117,452 S914P probably damaging Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr547 C A 7: 102,535,280 H178N probably benign Het
Olfr585 T C 7: 103,098,184 S148P probably damaging Het
Pcdh17 C T 14: 84,447,259 Q389* probably null Het
Prr14l T C 5: 32,830,345 E602G probably damaging Het
Rusc2 C A 4: 43,416,424 Q577K probably benign Het
Sacm1l T A 9: 123,587,576 M534K probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco4a1 C T 2: 180,464,091 T22M probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tas2r104 A T 6: 131,684,925 C274S probably benign Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trim43c T A 9: 88,840,401 H33Q probably damaging Het
Ttc17 A T 2: 94,369,413 I411K possibly damaging Het
Ttn G T 2: 76,751,334 L23072I possibly damaging Het
Ttn A C 2: 76,955,024 V669G possibly damaging Het
Vmn1r60 A T 7: 5,545,027 F25I possibly damaging Het
Vmn2r9 A G 5: 108,848,131 I217T probably damaging Het
Other mutations in Pik3r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Pik3r2 APN 8 70770429 missense probably damaging 1.00
IGL01637:Pik3r2 APN 8 70772348 unclassified probably benign
IGL02514:Pik3r2 APN 8 70770592 missense probably benign 0.00
IGL03395:Pik3r2 APN 8 70772355 missense probably benign
R0022:Pik3r2 UTSW 8 70770901 missense probably damaging 1.00
R0022:Pik3r2 UTSW 8 70770901 missense probably damaging 1.00
R0448:Pik3r2 UTSW 8 70772044 unclassified probably benign
R1636:Pik3r2 UTSW 8 70771898 missense probably benign
R1662:Pik3r2 UTSW 8 70770606 missense probably damaging 1.00
R2114:Pik3r2 UTSW 8 70769385 missense probably benign 0.31
R2879:Pik3r2 UTSW 8 70772385 missense probably benign
R3830:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3859:Pik3r2 UTSW 8 70769986 missense probably damaging 1.00
R3967:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3968:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3969:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3970:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R4606:Pik3r2 UTSW 8 70772136 nonsense probably null
R4666:Pik3r2 UTSW 8 70768859 missense possibly damaging 0.93
R5481:Pik3r2 UTSW 8 70769764 missense probably benign 0.31
R6445:Pik3r2 UTSW 8 70772026 missense probably benign 0.01
R6578:Pik3r2 UTSW 8 70772639 missense probably benign 0.00
R6667:Pik3r2 UTSW 8 70769173 missense probably damaging 1.00
R6794:Pik3r2 UTSW 8 70770717 missense probably benign 0.43
R6863:Pik3r2 UTSW 8 70770414 missense probably damaging 1.00
R7378:Pik3r2 UTSW 8 70769381 missense probably benign 0.03
R7750:Pik3r2 UTSW 8 70770901 missense probably damaging 1.00
R7821:Pik3r2 UTSW 8 70769764 missense probably damaging 1.00
R8056:Pik3r2 UTSW 8 70772367 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AACCTAGATTTGTAAGAAGCACTGG -3'
(R):5'- ATCACTGGCCCAGTACAACG -3'

Sequencing Primer
(F):5'- TTTGTAAGAAGCACTGGGAGGAAATG -3'
(R):5'- CTGTGTCCAAGTACCAACAAGTGTG -3'
Posted On2015-04-06