Incidental Mutation 'R3852:Dusp7'
ID275979
Institutional Source Beutler Lab
Gene Symbol Dusp7
Ensembl Gene ENSMUSG00000053716
Gene Namedual specificity phosphatase 7
SynonymsPYST2, MKP-X
MMRRC Submission 040784-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R3852 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location106368632-106375724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106373893 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 406 (S406T)
Ref Sequence ENSEMBL: ENSMUSP00000126984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172306]
Predicted Effect probably benign
Transcript: ENSMUST00000172306
AA Change: S406T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126984
Gene: ENSMUSG00000053716
AA Change: S406T

DomainStartEndE-ValueType
low complexity region 18 54 N/A INTRINSIC
RHOD 58 187 4.5e-11 SMART
low complexity region 195 213 N/A INTRINSIC
DSPc 247 387 8.53e-71 SMART
Blast:DSPc 393 416 8e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173051
Predicted Effect probably benign
Transcript: ENSMUST00000173748
SMART Domains Protein: ENSMUSP00000133511
Gene: ENSMUSG00000053716

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
DSPc 58 214 4.41e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193878
Meta Mutation Damage Score 0.0697 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dual-specificity phosphatases (DUSPs) constitute a large heterogeneous subgroup of the type I cysteine-based protein-tyrosine phosphatase superfamily. DUSPs are characterized by their ability to dephosphorylate both tyrosine and serine/threonine residues. DUSP7 belongs to a class of DUSPs, designated MKPs, that dephosphorylate MAPK (mitogen-activated protein kinase) proteins ERK (see MIM 601795), JNK (see MIM 601158), and p38 (see MIM 600289) with specificity distinct from that of individual MKP proteins. MKPs contain a highly conserved C-terminal catalytic domain and an N-terminal Cdc25 (see MIM 116947)-like (CH2) domain. MAPK activation cascades mediate various physiologic processes, including cellular proliferation, apoptosis, differentiation, and stress responses (summary by Patterson et al., 2009 [PubMed 19228121]).[supplied by OMIM, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T C 16: 20,560,439 V685A probably damaging Het
Abhd4 T C 14: 54,265,367 Y44H probably damaging Het
AI429214 A G 8: 36,994,442 D248G probably damaging Het
AY358078 A G 14: 51,805,553 T233A unknown Het
Calcr T C 6: 3,693,735 Y353C probably damaging Het
Ccdc34 A G 2: 110,032,428 K193E possibly damaging Het
Dhcr24 A G 4: 106,573,873 E253G probably benign Het
Dnah6 A G 6: 73,127,927 V1841A possibly damaging Het
Dpp10 A T 1: 123,485,924 Y186* probably null Het
Dpysl4 C T 7: 139,100,935 T575M probably damaging Het
Gga3 T A 11: 115,587,542 T475S probably benign Het
Gm10271 T A 10: 116,956,874 K36* probably null Het
Gm572 G A 4: 148,668,872 E325K possibly damaging Het
Golga2 A G 2: 32,305,611 E806G probably benign Het
Igf1 A T 10: 87,915,319 K126* probably null Het
Itpkc A T 7: 27,227,612 N292K probably benign Het
Klhl1 A T 14: 96,280,205 M345K probably benign Het
Lrp2 A G 2: 69,537,565 V201A probably damaging Het
Lrrc8a C T 2: 30,261,960 T757M probably benign Het
Mios T A 6: 8,216,453 I459K probably benign Het
Mrps11 T C 7: 78,790,645 I94T probably damaging Het
Ms4a4c T A 19: 11,416,395 S68T probably benign Het
Mstn C T 1: 53,061,971 T69I possibly damaging Het
Myo10 A G 15: 25,779,626 K28E probably damaging Het
Nol6 A G 4: 41,117,452 S914P probably damaging Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr547 C A 7: 102,535,280 H178N probably benign Het
Olfr585 T C 7: 103,098,184 S148P probably damaging Het
Pcdh17 C T 14: 84,447,259 Q389* probably null Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Prr14l T C 5: 32,830,345 E602G probably damaging Het
Rusc2 C A 4: 43,416,424 Q577K probably benign Het
Sacm1l T A 9: 123,587,576 M534K probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco4a1 C T 2: 180,464,091 T22M probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tas2r104 A T 6: 131,684,925 C274S probably benign Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trim43c T A 9: 88,840,401 H33Q probably damaging Het
Ttc17 A T 2: 94,369,413 I411K possibly damaging Het
Ttn G T 2: 76,751,334 L23072I possibly damaging Het
Ttn A C 2: 76,955,024 V669G possibly damaging Het
Vmn1r60 A T 7: 5,545,027 F25I possibly damaging Het
Vmn2r9 A G 5: 108,848,131 I217T probably damaging Het
Other mutations in Dusp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03181:Dusp7 APN 9 106373810 missense probably damaging 1.00
alessi UTSW 9 106373741 missense probably damaging 1.00
R1118:Dusp7 UTSW 9 106373650 missense possibly damaging 0.91
R1952:Dusp7 UTSW 9 106370829 missense probably benign 0.05
R2049:Dusp7 UTSW 9 106373897 missense probably damaging 1.00
R2408:Dusp7 UTSW 9 106369162 missense probably benign 0.30
R4632:Dusp7 UTSW 9 106370766 missense possibly damaging 0.64
R5022:Dusp7 UTSW 9 106373741 missense probably damaging 1.00
R6273:Dusp7 UTSW 9 106373896 missense possibly damaging 0.57
R6525:Dusp7 UTSW 9 106369284 missense possibly damaging 0.91
R7161:Dusp7 UTSW 9 106368915 missense unknown
R7575:Dusp7 UTSW 9 106373677 missense probably damaging 1.00
R7818:Dusp7 UTSW 9 106369130 missense probably benign 0.28
R7856:Dusp7 UTSW 9 106368868 missense unknown
R8811:Dusp7 UTSW 9 106371042 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTCCAAGAAGTGTGGTGTCTTG -3'
(R):5'- TCTGGACACAGGTGACATCTG -3'

Sequencing Primer
(F):5'- AGCCGTTCAGTGACAGTTAC -3'
(R):5'- ACATCTGTGGGTTCTTCAGGCC -3'
Posted On2015-04-06