Incidental Mutation 'R3852:Sacm1l'
ID275980
Institutional Source Beutler Lab
Gene Symbol Sacm1l
Ensembl Gene ENSMUSG00000025240
Gene NameSAC1 suppressor of actin mutations 1-like (yeast)
SynonymsSAC1, Sac1p
MMRRC Submission 040784-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3852 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location123529759-123592600 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123587576 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 534 (M534K)
Ref Sequence ENSEMBL: ENSMUSP00000026270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026270] [ENSMUST00000026273]
Predicted Effect probably damaging
Transcript: ENSMUST00000026270
AA Change: M534K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026270
Gene: ENSMUSG00000025240
AA Change: M534K

DomainStartEndE-ValueType
Pfam:Syja_N 58 346 4.7e-88 PFAM
low complexity region 400 415 N/A INTRINSIC
Blast:IPPc 416 500 3e-12 BLAST
transmembrane domain 521 543 N/A INTRINSIC
transmembrane domain 550 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026273
SMART Domains Protein: ENSMUSP00000026273
Gene: ENSMUSG00000025243

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
Pfam:SNF 48 624 5.4e-173 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217089
Meta Mutation Damage Score 0.9484 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is localized to the endoplasmic reticulum and golgi, and functions as a phosphoinositide lipid phosphatase. Studies in mammals suggest that this gene is involved in the organization of golgi membranes and the mitotic spindles. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T C 16: 20,560,439 V685A probably damaging Het
Abhd4 T C 14: 54,265,367 Y44H probably damaging Het
AI429214 A G 8: 36,994,442 D248G probably damaging Het
AY358078 A G 14: 51,805,553 T233A unknown Het
Calcr T C 6: 3,693,735 Y353C probably damaging Het
Ccdc34 A G 2: 110,032,428 K193E possibly damaging Het
Dhcr24 A G 4: 106,573,873 E253G probably benign Het
Dnah6 A G 6: 73,127,927 V1841A possibly damaging Het
Dpp10 A T 1: 123,485,924 Y186* probably null Het
Dpysl4 C T 7: 139,100,935 T575M probably damaging Het
Dusp7 T A 9: 106,373,893 S406T probably benign Het
Gga3 T A 11: 115,587,542 T475S probably benign Het
Gm10271 T A 10: 116,956,874 K36* probably null Het
Gm572 G A 4: 148,668,872 E325K possibly damaging Het
Golga2 A G 2: 32,305,611 E806G probably benign Het
Igf1 A T 10: 87,915,319 K126* probably null Het
Itpkc A T 7: 27,227,612 N292K probably benign Het
Klhl1 A T 14: 96,280,205 M345K probably benign Het
Lrp2 A G 2: 69,537,565 V201A probably damaging Het
Lrrc8a C T 2: 30,261,960 T757M probably benign Het
Mios T A 6: 8,216,453 I459K probably benign Het
Mrps11 T C 7: 78,790,645 I94T probably damaging Het
Ms4a4c T A 19: 11,416,395 S68T probably benign Het
Mstn C T 1: 53,061,971 T69I possibly damaging Het
Myo10 A G 15: 25,779,626 K28E probably damaging Het
Nol6 A G 4: 41,117,452 S914P probably damaging Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr547 C A 7: 102,535,280 H178N probably benign Het
Olfr585 T C 7: 103,098,184 S148P probably damaging Het
Pcdh17 C T 14: 84,447,259 Q389* probably null Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Prr14l T C 5: 32,830,345 E602G probably damaging Het
Rusc2 C A 4: 43,416,424 Q577K probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco4a1 C T 2: 180,464,091 T22M probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tas2r104 A T 6: 131,684,925 C274S probably benign Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trim43c T A 9: 88,840,401 H33Q probably damaging Het
Ttc17 A T 2: 94,369,413 I411K possibly damaging Het
Ttn G T 2: 76,751,334 L23072I possibly damaging Het
Ttn A C 2: 76,955,024 V669G possibly damaging Het
Vmn1r60 A T 7: 5,545,027 F25I possibly damaging Het
Vmn2r9 A G 5: 108,848,131 I217T probably damaging Het
Other mutations in Sacm1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Sacm1l APN 9 123570549 missense possibly damaging 0.88
IGL02598:Sacm1l APN 9 123578996 missense probably benign 0.03
IGL02796:Sacm1l UTSW 9 123548924 missense possibly damaging 0.66
R0138:Sacm1l UTSW 9 123548917 missense probably benign 0.15
R0628:Sacm1l UTSW 9 123548995 splice site probably benign
R0847:Sacm1l UTSW 9 123548862 missense probably damaging 1.00
R1102:Sacm1l UTSW 9 123582298 missense probably damaging 0.98
R1159:Sacm1l UTSW 9 123566411 missense probably benign 0.06
R2898:Sacm1l UTSW 9 123560601 critical splice donor site probably null
R3001:Sacm1l UTSW 9 123585084 splice site probably benign
R3780:Sacm1l UTSW 9 123552790 missense probably benign 0.00
R4731:Sacm1l UTSW 9 123590830 missense probably benign 0.03
R4732:Sacm1l UTSW 9 123590830 missense probably benign 0.03
R4733:Sacm1l UTSW 9 123590830 missense probably benign 0.03
R4894:Sacm1l UTSW 9 123582344 missense probably benign 0.17
R5021:Sacm1l UTSW 9 123582328 missense probably damaging 1.00
R5033:Sacm1l UTSW 9 123586399 missense probably damaging 1.00
R5075:Sacm1l UTSW 9 123582262 missense probably benign 0.00
R5135:Sacm1l UTSW 9 123577025 missense probably benign 0.00
R5284:Sacm1l UTSW 9 123586420 missense probably damaging 0.99
R5514:Sacm1l UTSW 9 123586354 nonsense probably null
R5629:Sacm1l UTSW 9 123566399 missense probably benign
R6137:Sacm1l UTSW 9 123569005 missense probably damaging 1.00
R6266:Sacm1l UTSW 9 123542420 missense probably damaging 1.00
R7079:Sacm1l UTSW 9 123569997 missense probably damaging 1.00
R7147:Sacm1l UTSW 9 123568951 missense probably damaging 1.00
R8205:Sacm1l UTSW 9 123586659 splice site probably null
R8323:Sacm1l UTSW 9 123548922 missense probably benign 0.22
R8544:Sacm1l UTSW 9 123577058 critical splice donor site probably null
R8801:Sacm1l UTSW 9 123582319 missense probably damaging 1.00
Z1177:Sacm1l UTSW 9 123577028 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GTCACTGTGATTGAAGCCATAATAG -3'
(R):5'- GTGCTGAGTGTACGTAAGACTC -3'

Sequencing Primer
(F):5'- ATTGAAGCCATAATAGTGTGTTTGG -3'
(R):5'- TTAATCACAGCACTTGGGGGC -3'
Posted On2015-04-06