Incidental Mutation 'R3852:Igf1'
ID275981
Institutional Source Beutler Lab
Gene Symbol Igf1
Ensembl Gene ENSMUSG00000020053
Gene Nameinsulin-like growth factor 1
SynonymsC730016P09Rik, Igf-I, Igf-1
MMRRC Submission 040784-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3852 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location87858265-87937042 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 87915319 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 126 (K126*)
Ref Sequence ENSEMBL: ENSMUSP00000122188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062862] [ENSMUST00000095360] [ENSMUST00000105300] [ENSMUST00000121161] [ENSMUST00000121952] [ENSMUST00000122100] [ENSMUST00000122386] [ENSMUST00000126490]
Predicted Effect probably null
Transcript: ENSMUST00000062862
AA Change: K126*
SMART Domains Protein: ENSMUSP00000056668
Gene: ENSMUSG00000020053
AA Change: K126*

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IlGF 35 93 9.22e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095360
SMART Domains Protein: ENSMUSP00000093005
Gene: ENSMUSG00000020053

DomainStartEndE-ValueType
IlGF 51 109 9.22e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105300
AA Change: K142*
SMART Domains Protein: ENSMUSP00000100937
Gene: ENSMUSG00000020053
AA Change: K142*

DomainStartEndE-ValueType
IlGF 51 109 9.22e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121161
SMART Domains Protein: ENSMUSP00000114120
Gene: ENSMUSG00000020053

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IlGF 35 93 9.22e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121952
SMART Domains Protein: ENSMUSP00000113177
Gene: ENSMUSG00000020053

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IlGF 35 93 9.22e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122100
AA Change: K126*
SMART Domains Protein: ENSMUSP00000112878
Gene: ENSMUSG00000020053
AA Change: K126*

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IlGF 35 93 9.22e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122386
SMART Domains Protein: ENSMUSP00000113905
Gene: ENSMUSG00000020053

DomainStartEndE-ValueType
IlGF 51 109 9.22e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000126490
AA Change: K126*
SMART Domains Protein: ENSMUSP00000122188
Gene: ENSMUSG00000020053
AA Change: K126*

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IlGF 35 93 9.22e-24 SMART
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: This gene encodes a member of the insulin-like growth factor (IGF) family of proteins that promote growth and development during fetal and postnatal life. This gene is predominantly expressed in the liver and the encoded protein undergoes proteolytic processing to generate a disulfide-linked mature polypeptide. Transgenic disruption of this gene in mice results in reduced postnatal survival and severe growth retardation. Mice lacking the encoded protein exhibit generalized organ hypoplasia including underdevelopment of the central nervous system and developmental defects in bone, muscle and reproductive systems. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants are severely growth retarded and die perinatally with many immature organ systems. Heterozygotes and partial knockouts show genetic background effects and can display growth retardation and abnormalities in muscle, lungs, and CNS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T C 16: 20,560,439 V685A probably damaging Het
Abhd4 T C 14: 54,265,367 Y44H probably damaging Het
AI429214 A G 8: 36,994,442 D248G probably damaging Het
AY358078 A G 14: 51,805,553 T233A unknown Het
Calcr T C 6: 3,693,735 Y353C probably damaging Het
Ccdc34 A G 2: 110,032,428 K193E possibly damaging Het
Dhcr24 A G 4: 106,573,873 E253G probably benign Het
Dnah6 A G 6: 73,127,927 V1841A possibly damaging Het
Dpp10 A T 1: 123,485,924 Y186* probably null Het
Dpysl4 C T 7: 139,100,935 T575M probably damaging Het
Dusp7 T A 9: 106,373,893 S406T probably benign Het
Gga3 T A 11: 115,587,542 T475S probably benign Het
Gm10271 T A 10: 116,956,874 K36* probably null Het
Gm572 G A 4: 148,668,872 E325K possibly damaging Het
Golga2 A G 2: 32,305,611 E806G probably benign Het
Itpkc A T 7: 27,227,612 N292K probably benign Het
Klhl1 A T 14: 96,280,205 M345K probably benign Het
Lrp2 A G 2: 69,537,565 V201A probably damaging Het
Lrrc8a C T 2: 30,261,960 T757M probably benign Het
Mios T A 6: 8,216,453 I459K probably benign Het
Mrps11 T C 7: 78,790,645 I94T probably damaging Het
Ms4a4c T A 19: 11,416,395 S68T probably benign Het
Mstn C T 1: 53,061,971 T69I possibly damaging Het
Myo10 A G 15: 25,779,626 K28E probably damaging Het
Nol6 A G 4: 41,117,452 S914P probably damaging Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr547 C A 7: 102,535,280 H178N probably benign Het
Olfr585 T C 7: 103,098,184 S148P probably damaging Het
Pcdh17 C T 14: 84,447,259 Q389* probably null Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Prr14l T C 5: 32,830,345 E602G probably damaging Het
Rusc2 C A 4: 43,416,424 Q577K probably benign Het
Sacm1l T A 9: 123,587,576 M534K probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco4a1 C T 2: 180,464,091 T22M probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tas2r104 A T 6: 131,684,925 C274S probably benign Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trim43c T A 9: 88,840,401 H33Q probably damaging Het
Ttc17 A T 2: 94,369,413 I411K possibly damaging Het
Ttn G T 2: 76,751,334 L23072I possibly damaging Het
Ttn A C 2: 76,955,024 V669G possibly damaging Het
Vmn1r60 A T 7: 5,545,027 F25I possibly damaging Het
Vmn2r9 A G 5: 108,848,131 I217T probably damaging Het
Other mutations in Igf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02485:Igf1 APN 10 87864746 missense probably benign
IGL03171:Igf1 APN 10 87864821 missense probably damaging 1.00
R1850:Igf1 UTSW 10 87861374 missense possibly damaging 0.47
R1962:Igf1 UTSW 10 87864864 missense probably damaging 1.00
R2428:Igf1 UTSW 10 87864821 missense probably damaging 1.00
R4757:Igf1 UTSW 10 87915425 missense probably benign 0.01
R6893:Igf1 UTSW 10 87864860 missense probably damaging 1.00
R6954:Igf1 UTSW 10 87864860 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACGGTGGGCACAAGAGTC -3'
(R):5'- TCTAGCTTAGTGAGGACTGCC -3'

Sequencing Primer
(F):5'- AGTCAGAAAGGATATCACTGTGC -3'
(R):5'- AGGACTGCCTTGCTTCAGC -3'
Posted On2015-04-06