Incidental Mutation 'R3852:Gga3'
ID275984
Institutional Source Beutler Lab
Gene Symbol Gga3
Ensembl Gene ENSMUSG00000020740
Gene Namegolgi associated, gamma adaptin ear containing, ARF binding protein 3
Synonyms
MMRRC Submission 040784-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.815) question?
Stock #R3852 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115584255-115604051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115587542 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 475 (T475S)
Ref Sequence ENSEMBL: ENSMUSP00000019135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019135] [ENSMUST00000021085] [ENSMUST00000106508] [ENSMUST00000125097] [ENSMUST00000156173]
Predicted Effect probably benign
Transcript: ENSMUST00000019135
AA Change: T475S

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000019135
Gene: ENSMUSG00000020740
AA Change: T475S

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 222 299 1.7e-20 PFAM
low complexity region 334 369 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
low complexity region 455 471 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Alpha_adaptinC2 586 710 6.09e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021085
SMART Domains Protein: ENSMUSP00000021085
Gene: ENSMUSG00000020739

DomainStartEndE-ValueType
Pfam:Nucleopor_Nup85 53 606 1.2e-181 PFAM
low complexity region 635 649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106508
AA Change: T397S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102117
Gene: ENSMUSG00000020740
AA Change: T397S

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 206 307 1.3e-32 PFAM
low complexity region 377 393 N/A INTRINSIC
low complexity region 405 420 N/A INTRINSIC
low complexity region 454 476 N/A INTRINSIC
Alpha_adaptinC2 508 632 6.09e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123831
Predicted Effect probably benign
Transcript: ENSMUST00000125097
SMART Domains Protein: ENSMUSP00000118024
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
Pfam:VHS 3 106 3.4e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154832
Predicted Effect probably benign
Transcript: ENSMUST00000156173
AA Change: T475S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000138597
Gene: ENSMUSG00000020740
AA Change: T475S

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 206 307 7.3e-32 PFAM
low complexity region 334 369 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
low complexity region 455 471 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Golgi-localized, gamma adaptin ear-containing, ARF-binding (GGA) family. This family includes ubiquitous coat proteins that regulate the trafficking of proteins between the trans-Golgi network and the lysosome. These proteins share an amino-terminal VHS domain which mediates sorting of the mannose 6-phosphate receptors at the trans-Golgi network. They also contain a carboxy-terminal region with homology to the ear domain of gamma-adaptins. Multiple alternatively spliced transcript variants have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a gene-trapped allele display decreased birth weight, slow postnatal weight gain, hypoglycemia, increased plasma levels of acid hydrolases, and partial neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T C 16: 20,560,439 V685A probably damaging Het
Abhd4 T C 14: 54,265,367 Y44H probably damaging Het
AI429214 A G 8: 36,994,442 D248G probably damaging Het
AY358078 A G 14: 51,805,553 T233A unknown Het
Calcr T C 6: 3,693,735 Y353C probably damaging Het
Ccdc34 A G 2: 110,032,428 K193E possibly damaging Het
Dhcr24 A G 4: 106,573,873 E253G probably benign Het
Dnah6 A G 6: 73,127,927 V1841A possibly damaging Het
Dpp10 A T 1: 123,485,924 Y186* probably null Het
Dpysl4 C T 7: 139,100,935 T575M probably damaging Het
Dusp7 T A 9: 106,373,893 S406T probably benign Het
Gm10271 T A 10: 116,956,874 K36* probably null Het
Gm572 G A 4: 148,668,872 E325K possibly damaging Het
Golga2 A G 2: 32,305,611 E806G probably benign Het
Igf1 A T 10: 87,915,319 K126* probably null Het
Itpkc A T 7: 27,227,612 N292K probably benign Het
Klhl1 A T 14: 96,280,205 M345K probably benign Het
Lrp2 A G 2: 69,537,565 V201A probably damaging Het
Lrrc8a C T 2: 30,261,960 T757M probably benign Het
Mios T A 6: 8,216,453 I459K probably benign Het
Mrps11 T C 7: 78,790,645 I94T probably damaging Het
Ms4a4c T A 19: 11,416,395 S68T probably benign Het
Mstn C T 1: 53,061,971 T69I possibly damaging Het
Myo10 A G 15: 25,779,626 K28E probably damaging Het
Nol6 A G 4: 41,117,452 S914P probably damaging Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr547 C A 7: 102,535,280 H178N probably benign Het
Olfr585 T C 7: 103,098,184 S148P probably damaging Het
Pcdh17 C T 14: 84,447,259 Q389* probably null Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Prr14l T C 5: 32,830,345 E602G probably damaging Het
Rusc2 C A 4: 43,416,424 Q577K probably benign Het
Sacm1l T A 9: 123,587,576 M534K probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco4a1 C T 2: 180,464,091 T22M probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tas2r104 A T 6: 131,684,925 C274S probably benign Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trim43c T A 9: 88,840,401 H33Q probably damaging Het
Ttc17 A T 2: 94,369,413 I411K possibly damaging Het
Ttn G T 2: 76,751,334 L23072I possibly damaging Het
Ttn A C 2: 76,955,024 V669G possibly damaging Het
Vmn1r60 A T 7: 5,545,027 F25I possibly damaging Het
Vmn2r9 A G 5: 108,848,131 I217T probably damaging Het
Other mutations in Gga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Gga3 APN 11 115591741 missense probably damaging 1.00
IGL01449:Gga3 APN 11 115589102 missense probably damaging 1.00
IGL03343:Gga3 APN 11 115592486 missense probably damaging 0.99
IGL03390:Gga3 APN 11 115586994 critical splice donor site probably null
R0049:Gga3 UTSW 11 115587089 nonsense probably null
R0133:Gga3 UTSW 11 115588979 splice site probably benign
R0411:Gga3 UTSW 11 115587433 missense probably damaging 1.00
R0432:Gga3 UTSW 11 115590524 missense probably damaging 1.00
R0865:Gga3 UTSW 11 115592459 missense probably damaging 1.00
R4869:Gga3 UTSW 11 115586285 intron probably benign
R4878:Gga3 UTSW 11 115591321 missense probably damaging 1.00
R5380:Gga3 UTSW 11 115588431 missense probably damaging 1.00
R5527:Gga3 UTSW 11 115587436 missense probably damaging 0.98
R6545:Gga3 UTSW 11 115587169 missense possibly damaging 0.71
R6805:Gga3 UTSW 11 115585762 missense probably damaging 1.00
R6967:Gga3 UTSW 11 115591276 missense probably damaging 1.00
Z1176:Gga3 UTSW 11 115587603 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCAGCCTGACTCACAGTAC -3'
(R):5'- CCACCATCAGATCTGGACTTC -3'

Sequencing Primer
(F):5'- TGGTCCTATATATACGACACCCC -3'
(R):5'- ACCATCAGATCTGGACTTCTTCAG -3'
Posted On2015-04-06