Incidental Mutation 'R3852:Abhd4'
ID275986
Institutional Source Beutler Lab
Gene Symbol Abhd4
Ensembl Gene ENSMUSG00000040997
Gene Nameabhydrolase domain containing 4
Synonyms
MMRRC Submission 040784-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R3852 (G1)
Quality Score200
Status Validated
Chromosome14
Chromosomal Location54254188-54270637 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54265367 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 44 (Y44H)
Ref Sequence ENSEMBL: ENSMUSP00000142607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041197] [ENSMUST00000180359] [ENSMUST00000196699] [ENSMUST00000197605] [ENSMUST00000197807] [ENSMUST00000199338]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041197
AA Change: Y256H

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000044134
Gene: ENSMUSG00000040997
AA Change: Y256H

DomainStartEndE-ValueType
Pfam:Hydrolase_4 78 340 1.1e-14 PFAM
Pfam:Abhydrolase_1 82 340 5.1e-26 PFAM
Pfam:Abhydrolase_5 83 334 5.8e-12 PFAM
Pfam:Abhydrolase_6 84 346 4.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180359
AA Change: Y219H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137214
Gene: ENSMUSG00000040997
AA Change: Y219H

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 46 297 4.3e-12 PFAM
Pfam:Abhydrolase_6 47 309 3.5e-34 PFAM
Pfam:Abhydrolase_1 71 311 5.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196699
Predicted Effect probably benign
Transcript: ENSMUST00000197605
SMART Domains Protein: ENSMUSP00000142722
Gene: ENSMUSG00000040997

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 46 182 3.5e-10 PFAM
Pfam:Abhydrolase_6 47 186 1.6e-23 PFAM
Pfam:Abhydrolase_1 71 179 2.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197802
Predicted Effect probably damaging
Transcript: ENSMUST00000197807
AA Change: Y44H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect unknown
Transcript: ENSMUST00000199068
AA Change: Y97H
Predicted Effect probably benign
Transcript: ENSMUST00000199338
SMART Domains Protein: ENSMUSP00000143600
Gene: ENSMUSG00000040997

DomainStartEndE-ValueType
SCOP:d1ehya_ 1 78 3e-6 SMART
Meta Mutation Damage Score 0.2914 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T C 16: 20,560,439 V685A probably damaging Het
AI429214 A G 8: 36,994,442 D248G probably damaging Het
AY358078 A G 14: 51,805,553 T233A unknown Het
Calcr T C 6: 3,693,735 Y353C probably damaging Het
Ccdc34 A G 2: 110,032,428 K193E possibly damaging Het
Dhcr24 A G 4: 106,573,873 E253G probably benign Het
Dnah6 A G 6: 73,127,927 V1841A possibly damaging Het
Dpp10 A T 1: 123,485,924 Y186* probably null Het
Dpysl4 C T 7: 139,100,935 T575M probably damaging Het
Dusp7 T A 9: 106,373,893 S406T probably benign Het
Gga3 T A 11: 115,587,542 T475S probably benign Het
Gm10271 T A 10: 116,956,874 K36* probably null Het
Gm572 G A 4: 148,668,872 E325K possibly damaging Het
Golga2 A G 2: 32,305,611 E806G probably benign Het
Igf1 A T 10: 87,915,319 K126* probably null Het
Itpkc A T 7: 27,227,612 N292K probably benign Het
Klhl1 A T 14: 96,280,205 M345K probably benign Het
Lrp2 A G 2: 69,537,565 V201A probably damaging Het
Lrrc8a C T 2: 30,261,960 T757M probably benign Het
Mios T A 6: 8,216,453 I459K probably benign Het
Mrps11 T C 7: 78,790,645 I94T probably damaging Het
Ms4a4c T A 19: 11,416,395 S68T probably benign Het
Mstn C T 1: 53,061,971 T69I possibly damaging Het
Myo10 A G 15: 25,779,626 K28E probably damaging Het
Nol6 A G 4: 41,117,452 S914P probably damaging Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr547 C A 7: 102,535,280 H178N probably benign Het
Olfr585 T C 7: 103,098,184 S148P probably damaging Het
Pcdh17 C T 14: 84,447,259 Q389* probably null Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Prr14l T C 5: 32,830,345 E602G probably damaging Het
Rusc2 C A 4: 43,416,424 Q577K probably benign Het
Sacm1l T A 9: 123,587,576 M534K probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco4a1 C T 2: 180,464,091 T22M probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tas2r104 A T 6: 131,684,925 C274S probably benign Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trim43c T A 9: 88,840,401 H33Q probably damaging Het
Ttc17 A T 2: 94,369,413 I411K possibly damaging Het
Ttn G T 2: 76,751,334 L23072I possibly damaging Het
Ttn A C 2: 76,955,024 V669G possibly damaging Het
Vmn1r60 A T 7: 5,545,027 F25I possibly damaging Het
Vmn2r9 A G 5: 108,848,131 I217T probably damaging Het
Other mutations in Abhd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Abhd4 APN 14 54267132 missense probably damaging 0.99
IGL02717:Abhd4 APN 14 54261622 intron probably benign
R0254:Abhd4 UTSW 14 54263234 missense probably benign 0.02
R0571:Abhd4 UTSW 14 54263249 missense possibly damaging 0.73
R2015:Abhd4 UTSW 14 54262832 missense probably damaging 0.99
R3974:Abhd4 UTSW 14 54262960 missense probably damaging 1.00
R5806:Abhd4 UTSW 14 54261690 missense probably benign 0.33
R7029:Abhd4 UTSW 14 54262707 missense probably damaging 0.99
R7697:Abhd4 UTSW 14 54262759 missense probably damaging 0.99
R7909:Abhd4 UTSW 14 54261630 nonsense probably null
R8234:Abhd4 UTSW 14 54261676 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATAAGCGGGCAGGAGTTC -3'
(R):5'- TGTCTCCTAGAGCTCTGGTGAC -3'

Sequencing Primer
(F):5'- CGACCTTGAGCTTGAAACAGTTC -3'
(R):5'- AAGCAGTAGCTCAAAGCC -3'
Posted On2015-04-06