Mutagenetix > Incidental Mutation

Incidental Mutation 'R3852:Pcdh17'

275987

Institutional Source

Beutler Lab

Gene Symbol

Pcdh17

Ensembl Gene

ENSMUSG00000035566

Gene Name

protocadherin 17

Synonyms

C030033F14Rik, LOC219228

MMRRC Submission

040784-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.131) question?

Stock #

R3852 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84443563-84539002 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 84447259 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 389 (Q389*)

Ref Sequence

ENSEMBL: ENSMUSP00000071325 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071370]

AlphaFold

E9PXF0

Predicted Effect

probably null
Transcript: ENSMUST00000071370
AA Change: Q389*

SMART Domains

Protein: ENSMUSP00000071325
Gene: ENSMUSG00000035566
AA Change: Q389*

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
CA	54	131	6.8e-4	SMART
CA	155	242	8.81e-21	SMART
CA	266	350	8.27e-26	SMART
CA	375	468	9.14e-28	SMART
CA	492	579	8.4e-27	SMART
CA	608	687	2.53e-12	SMART
low complexity region	703	725	N/A	INTRINSIC
low complexity region	751	759	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226362

Meta Mutation Damage Score

0.9718

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

96% (45/47)

MGI Phenotype

FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein contains six extracellular cadherin domains, a transmembrane domain, and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein may play a role in the establishment and function of specific cell-cell connections in the brain. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired synaptic transmission, increased synaptic vesicle number and decreased depression-related behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcf3	T	C	16: 20,560,439	V685A	probably damaging	Het
Abhd4	T	C	14: 54,265,367	Y44H	probably damaging	Het
AI429214	A	G	8: 36,994,442	D248G	probably damaging	Het
AY358078	A	G	14: 51,805,553	T233A	unknown	Het
Calcr	T	C	6: 3,693,735	Y353C	probably damaging	Het
Ccdc34	A	G	2: 110,032,428	K193E	possibly damaging	Het
Dhcr24	A	G	4: 106,573,873	E253G	probably benign	Het
Dnah6	A	G	6: 73,127,927	V1841A	possibly damaging	Het
Dpp10	A	T	1: 123,485,924	Y186*	probably null	Het
Dpysl4	C	T	7: 139,100,935	T575M	probably damaging	Het
Dusp7	T	A	9: 106,373,893	S406T	probably benign	Het
Gga3	T	A	11: 115,587,542	T475S	probably benign	Het
Gm10271	T	A	10: 116,956,874	K36*	probably null	Het
Gm572	G	A	4: 148,668,872	E325K	possibly damaging	Het
Golga2	A	G	2: 32,305,611	E806G	probably benign	Het
Igf1	A	T	10: 87,915,319	K126*	probably null	Het
Itpkc	A	T	7: 27,227,612	N292K	probably benign	Het
Klhl1	A	T	14: 96,280,205	M345K	probably benign	Het
Lrp2	A	G	2: 69,537,565	V201A	probably damaging	Het
Lrrc8a	C	T	2: 30,261,960	T757M	probably benign	Het
Mios	T	A	6: 8,216,453	I459K	probably benign	Het
Mrps11	T	C	7: 78,790,645	I94T	probably damaging	Het
Ms4a4c	T	A	19: 11,416,395	S68T	probably benign	Het
Mstn	C	T	1: 53,061,971	T69I	possibly damaging	Het
Myo10	A	G	15: 25,779,626	K28E	probably damaging	Het
Nol6	A	G	4: 41,117,452	S914P	probably damaging	Het
Ntn1	C	G	11: 68,385,793	D110H	probably damaging	Het
Olfr547	C	A	7: 102,535,280	H178N	probably benign	Het
Olfr585	T	C	7: 103,098,184	S148P	probably damaging	Het
Pik3r2	G	A	8: 70,770,421	R452C	probably benign	Het
Prr14l	T	C	5: 32,830,345	E602G	probably damaging	Het
Rusc2	C	A	4: 43,416,424	Q577K	probably benign	Het
Sacm1l	T	A	9: 123,587,576	M534K	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slco4a1	C	T	2: 180,464,091	T22M	probably benign	Het
Svs1	C	T	6: 48,987,994	P312L	possibly damaging	Het
Tas2r104	A	T	6: 131,684,925	C274S	probably benign	Het
Tnrc6c	C	T	11: 117,723,529	R838W	probably damaging	Het
Trim43c	T	A	9: 88,840,401	H33Q	probably damaging	Het
Ttc17	A	T	2: 94,369,413	I411K	possibly damaging	Het
Ttn	G	T	2: 76,751,334	L23072I	possibly damaging	Het
Ttn	A	C	2: 76,955,024	V669G	possibly damaging	Het
Vmn1r60	A	T	7: 5,545,027	F25I	possibly damaging	Het
Vmn2r9	A	G	5: 108,848,131	I217T	probably damaging	Het

Other mutations in Pcdh17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Pcdh17	APN	14	84447544	missense	probably damaging	1.00
IGL00902:Pcdh17	APN	14	84446849	missense	probably damaging	1.00
IGL01596:Pcdh17	APN	14	84448192	missense	probably damaging	1.00
IGL01665:Pcdh17	APN	14	84447002	missense	probably damaging	0.99
IGL01944:Pcdh17	APN	14	84447520	missense	probably benign	0.01
IGL01944:Pcdh17	APN	14	84447521	missense	probably damaging	0.98
IGL01977:Pcdh17	APN	14	84533097	missense	possibly damaging	0.49
IGL01988:Pcdh17	APN	14	84446622	missense	probably damaging	1.00
IGL02168:Pcdh17	APN	14	84533195	missense	probably benign	0.19
IGL02500:Pcdh17	APN	14	84533469	missense	probably benign	0.17
IGL02874:Pcdh17	APN	14	84448240	missense	possibly damaging	0.71
IGL02882:Pcdh17	APN	14	84446661	missense	probably damaging	0.98
IGL02941:Pcdh17	APN	14	84448307	missense	probably damaging	1.00
IGL03328:Pcdh17	APN	14	84533111	missense	probably benign
R0226_Pcdh17_958	UTSW	14	84448201	missense	probably damaging	0.99
R3405_Pcdh17_345	UTSW	14	84446622	missense	probably damaging	1.00
PIT4151001:Pcdh17	UTSW	14	84447358	missense	probably benign	0.05
R0226:Pcdh17	UTSW	14	84448201	missense	probably damaging	0.99
R0537:Pcdh17	UTSW	14	84447457	missense	probably damaging	1.00
R0647:Pcdh17	UTSW	14	84447773	missense	possibly damaging	0.58
R0939:Pcdh17	UTSW	14	84447755	missense	probably damaging	1.00
R1014:Pcdh17	UTSW	14	84447488	missense	probably damaging	1.00
R1753:Pcdh17	UTSW	14	84477654	missense	probably benign	0.17
R3404:Pcdh17	UTSW	14	84446622	missense	probably damaging	1.00
R3405:Pcdh17	UTSW	14	84446622	missense	probably damaging	1.00
R3406:Pcdh17	UTSW	14	84446622	missense	probably damaging	1.00
R3746:Pcdh17	UTSW	14	84533037	missense	probably benign	0.02
R4015:Pcdh17	UTSW	14	84447107	missense	probably damaging	0.99
R4348:Pcdh17	UTSW	14	84447620	missense	probably damaging	0.97
R4365:Pcdh17	UTSW	14	84448286	missense	probably damaging	0.97
R4375:Pcdh17	UTSW	14	84448271	missense	possibly damaging	0.80
R4693:Pcdh17	UTSW	14	84533520	missense	probably damaging	1.00
R4811:Pcdh17	UTSW	14	84447935	missense	probably damaging	1.00
R5007:Pcdh17	UTSW	14	84533297	missense	probably benign
R5074:Pcdh17	UTSW	14	84533342	missense	probably benign
R5080:Pcdh17	UTSW	14	84533310	missense	probably benign	0.01
R5138:Pcdh17	UTSW	14	84447209	missense	probably damaging	1.00
R5330:Pcdh17	UTSW	14	84533046	missense	probably damaging	1.00
R5541:Pcdh17	UTSW	14	84447416	missense	probably damaging	0.97
R5686:Pcdh17	UTSW	14	84532993	missense	probably damaging	1.00
R5692:Pcdh17	UTSW	14	84448540	missense	probably benign	0.22
R5695:Pcdh17	UTSW	14	84446360	missense	probably damaging	1.00
R5949:Pcdh17	UTSW	14	84447556	missense	probably damaging	1.00
R6127:Pcdh17	UTSW	14	84533060	missense	probably damaging	0.96
R6294:Pcdh17	UTSW	14	84477668	missense	probably benign	0.01
R6508:Pcdh17	UTSW	14	84447979	missense	probably damaging	1.00
R6726:Pcdh17	UTSW	14	84446217	missense	probably damaging	1.00
R7094:Pcdh17	UTSW	14	84447395	missense	probably damaging	1.00
R7137:Pcdh17	UTSW	14	84533549	missense	possibly damaging	0.65
R7828:Pcdh17	UTSW	14	84532985	missense	probably damaging	0.99
R7904:Pcdh17	UTSW	14	84448484	missense	possibly damaging	0.94
R8507:Pcdh17	UTSW	14	84445944	start gained	probably benign
R9069:Pcdh17	UTSW	14	84447644	missense	possibly damaging	0.58
R9239:Pcdh17	UTSW	14	84533209	missense	probably benign	0.45
R9283:Pcdh17	UTSW	14	84448153	missense	possibly damaging	0.78
R9382:Pcdh17	UTSW	14	84448082	missense	probably damaging	1.00
R9402:Pcdh17	UTSW	14	84447206	missense	probably damaging	1.00
R9459:Pcdh17	UTSW	14	84448623	missense	probably benign	0.00
R9548:Pcdh17	UTSW	14	84447962	missense	possibly damaging	0.67
R9560:Pcdh17	UTSW	14	84533458	missense	probably benign	0.00
R9777:Pcdh17	UTSW	14	84446243	missense	probably benign	0.00
R9792:Pcdh17	UTSW	14	84532910	nonsense	probably null
R9793:Pcdh17	UTSW	14	84532910	nonsense	probably null
R9794:Pcdh17	UTSW	14	84532910	nonsense	probably null
R9795:Pcdh17	UTSW	14	84532910	nonsense	probably null
X0025:Pcdh17	UTSW	14	84446562	missense	possibly damaging	0.86
X0026:Pcdh17	UTSW	14	84533097	missense	possibly damaging	0.49
X0027:Pcdh17	UTSW	14	84448310	missense	possibly damaging	0.80
Z1088:Pcdh17	UTSW	14	84448274	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- TGTTGGAGATCGACGTGCAG -3'
(R):5'- TCTTGACGGCGAAGGACTTG -3'

Sequencing Primer
(F):5'- TGCAGGCCAGAGACCTAG -3'
(R):5'- TTAAGTGGAGGGGAGCCC -3'

Posted On

2015-04-06