Mutagenetix > Incidental Mutations

Incidental Mutation 'R3852:Klhl1'

275988

Institutional Source

Beutler Lab

Gene Symbol

Klhl1

Ensembl Gene

ENSMUSG00000022076

Gene Name

kelch-like 1

Synonyms

MMRRC Submission

040784-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.149) question?

Stock #

R3852 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

96102736-96519102 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 96280205 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 345 (M345K)

Ref Sequence

ENSEMBL: ENSMUSP00000022666 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022666]

Predicted Effect

probably benign
Transcript: ENSMUST00000022666
AA Change: M345K

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000022666
Gene: ENSMUSG00000022076
AA Change: M345K

Domain	Start	End	E-Value	Type
low complexity region	25	36	N/A	INTRINSIC
low complexity region	74	90	N/A	INTRINSIC
low complexity region	107	119	N/A	INTRINSIC
BTB	215	312	1.13e-28	SMART
BACK	317	418	5.03e-34	SMART
Kelch	463	509	8.86e-10	SMART
Kelch	510	556	1.04e-15	SMART
Kelch	557	603	6.76e-15	SMART
Kelch	604	650	2.23e-15	SMART
Kelch	651	703	3.09e-9	SMART
Kelch	704	750	3.43e-16	SMART

Meta Mutation Damage Score

0.1434

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

96% (45/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The KLHL1 protein belongs to a family of actin-organizing proteins related to Drosophila Kelch (Nemes et al., 2000 [PubMed 10888605]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice both homozygous and heterozygous for disruption of this gene develop abnormalities in gait and defects in motor coordination with time. Dendritic atrophy of Purkinje cells is also seen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcf3	T	C	16: 20,560,439	V685A	probably damaging	Het
Abhd4	T	C	14: 54,265,367	Y44H	probably damaging	Het
AI429214	A	G	8: 36,994,442	D248G	probably damaging	Het
AY358078	A	G	14: 51,805,553	T233A	unknown	Het
Calcr	T	C	6: 3,693,735	Y353C	probably damaging	Het
Ccdc34	A	G	2: 110,032,428	K193E	possibly damaging	Het
Dhcr24	A	G	4: 106,573,873	E253G	probably benign	Het
Dnah6	A	G	6: 73,127,927	V1841A	possibly damaging	Het
Dpp10	A	T	1: 123,485,924	Y186*	probably null	Het
Dpysl4	C	T	7: 139,100,935	T575M	probably damaging	Het
Dusp7	T	A	9: 106,373,893	S406T	probably benign	Het
Gga3	T	A	11: 115,587,542	T475S	probably benign	Het
Gm10271	T	A	10: 116,956,874	K36*	probably null	Het
Gm572	G	A	4: 148,668,872	E325K	possibly damaging	Het
Golga2	A	G	2: 32,305,611	E806G	probably benign	Het
Igf1	A	T	10: 87,915,319	K126*	probably null	Het
Itpkc	A	T	7: 27,227,612	N292K	probably benign	Het
Lrp2	A	G	2: 69,537,565	V201A	probably damaging	Het
Lrrc8a	C	T	2: 30,261,960	T757M	probably benign	Het
Mios	T	A	6: 8,216,453	I459K	probably benign	Het
Mrps11	T	C	7: 78,790,645	I94T	probably damaging	Het
Ms4a4c	T	A	19: 11,416,395	S68T	probably benign	Het
Mstn	C	T	1: 53,061,971	T69I	possibly damaging	Het
Myo10	A	G	15: 25,779,626	K28E	probably damaging	Het
Nol6	A	G	4: 41,117,452	S914P	probably damaging	Het
Ntn1	C	G	11: 68,385,793	D110H	probably damaging	Het
Olfr547	C	A	7: 102,535,280	H178N	probably benign	Het
Olfr585	T	C	7: 103,098,184	S148P	probably damaging	Het
Pcdh17	C	T	14: 84,447,259	Q389*	probably null	Het
Pik3r2	G	A	8: 70,770,421	R452C	probably benign	Het
Prr14l	T	C	5: 32,830,345	E602G	probably damaging	Het
Rusc2	C	A	4: 43,416,424	Q577K	probably benign	Het
Sacm1l	T	A	9: 123,587,576	M534K	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slco4a1	C	T	2: 180,464,091	T22M	probably benign	Het
Svs1	C	T	6: 48,987,994	P312L	possibly damaging	Het
Tas2r104	A	T	6: 131,684,925	C274S	probably benign	Het
Tnrc6c	C	T	11: 117,723,529	R838W	probably damaging	Het
Trim43c	T	A	9: 88,840,401	H33Q	probably damaging	Het
Ttc17	A	T	2: 94,369,413	I411K	possibly damaging	Het
Ttn	G	T	2: 76,751,334	L23072I	possibly damaging	Het
Ttn	A	C	2: 76,955,024	V669G	possibly damaging	Het
Vmn1r60	A	T	7: 5,545,027	F25I	possibly damaging	Het
Vmn2r9	A	G	5: 108,848,131	I217T	probably damaging	Het

Other mutations in Klhl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01573:Klhl1	APN	14	96201204	splice site	probably benign
IGL02055:Klhl1	APN	14	96280103	missense	possibly damaging	0.96
IGL02110:Klhl1	APN	14	96136603	missense	probably benign	0.27
IGL02216:Klhl1	APN	14	96123222	missense	probably benign	0.08
IGL02307:Klhl1	APN	14	96201373	missense	possibly damaging	0.68
IGL02538:Klhl1	APN	14	96240213	missense	probably benign	0.03
IGL02559:Klhl1	APN	14	96151960	missense	possibly damaging	0.95
IGL02682:Klhl1	APN	14	96201342	missense	possibly damaging	0.83
IGL03228:Klhl1	APN	14	96240327	missense	probably damaging	1.00
LCD18:Klhl1	UTSW	14	96317730	intron	probably benign
P0041:Klhl1	UTSW	14	96280211	missense	probably damaging	1.00
R0270:Klhl1	UTSW	14	96518344	start gained	probably benign
R0419:Klhl1	UTSW	14	96381789	missense	probably benign	0.30
R0938:Klhl1	UTSW	14	96152040	nonsense	probably null
R1465:Klhl1	UTSW	14	96240213	missense	probably benign	0.03
R1465:Klhl1	UTSW	14	96240213	missense	probably benign	0.03
R1590:Klhl1	UTSW	14	96368636	missense	probably damaging	1.00
R1597:Klhl1	UTSW	14	96201211	critical splice donor site	probably null
R1893:Klhl1	UTSW	14	96240206	critical splice donor site	probably null
R1928:Klhl1	UTSW	14	96346789	missense	probably benign	0.02
R2272:Klhl1	UTSW	14	96517908	missense	probably benign	0.00
R3612:Klhl1	UTSW	14	96381770	critical splice donor site	probably null
R3872:Klhl1	UTSW	14	96518179	missense	probably benign	0.03
R3874:Klhl1	UTSW	14	96518179	missense	probably benign	0.03
R3923:Klhl1	UTSW	14	96346880	missense	possibly damaging	0.46
R3925:Klhl1	UTSW	14	96346880	missense	possibly damaging	0.46
R3926:Klhl1	UTSW	14	96346880	missense	possibly damaging	0.46
R4151:Klhl1	UTSW	14	96518316	start codon destroyed	probably null	0.73
R4502:Klhl1	UTSW	14	96517846	missense	probably benign
R4536:Klhl1	UTSW	14	96136583	critical splice donor site	probably null
R4729:Klhl1	UTSW	14	96280148	missense	probably damaging	1.00
R4756:Klhl1	UTSW	14	96151966	missense	probably benign	0.39
R5001:Klhl1	UTSW	14	96136610	missense	probably damaging	0.96
R5022:Klhl1	UTSW	14	96136706	missense	probably benign	0.31
R5616:Klhl1	UTSW	14	96518293	missense	probably benign	0.44
R5634:Klhl1	UTSW	14	96240271	missense	probably damaging	0.96
R5700:Klhl1	UTSW	14	96518040	missense	probably benign
R5701:Klhl1	UTSW	14	96201380	missense	probably benign
R5934:Klhl1	UTSW	14	96123215	critical splice donor site	probably null
R5950:Klhl1	UTSW	14	96240354	missense	probably damaging	0.99
R6454:Klhl1	UTSW	14	96280091	missense	possibly damaging	0.66
R6496:Klhl1	UTSW	14	96240216	missense	probably benign	0.03
R6606:Klhl1	UTSW	14	96123222	missense	possibly damaging	0.52
R6644:Klhl1	UTSW	14	96517918	missense	probably benign
R6745:Klhl1	UTSW	14	96280002	critical splice donor site	probably null
R6919:Klhl1	UTSW	14	96136594	missense	probably benign	0.00
R7029:Klhl1	UTSW	14	96518196	missense	probably benign	0.01
R7195:Klhl1	UTSW	14	96280077	missense	probably benign	0.08
R7467:Klhl1	UTSW	14	96123277	missense	probably damaging	1.00
R7483:Klhl1	UTSW	14	96346868	missense	probably benign	0.09
R7650:Klhl1	UTSW	14	96346943	missense	probably damaging	0.96
R7817:Klhl1	UTSW	14	96136750	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- AGGAGCATACTCAGGTCACTAC -3'
(R):5'- AGCTGTGCATTATAATCCTCCAG -3'

Sequencing Primer
(F):5'- GGAGCATACTCAGGTCACTACATCTC -3'
(R):5'- CAAGATTTCTGCTGTCTTGGATAC -3'

Posted On

2015-04-06