Incidental Mutation 'R3852:Abcf3'
ID 275991
Institutional Source Beutler Lab
Gene Symbol Abcf3
Ensembl Gene ENSMUSG00000003234
Gene Name ATP-binding cassette, sub-family F member 3
Synonyms
MMRRC Submission 040784-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.116) question?
Stock # R3852 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 20367327-20380129 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20379189 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 685 (V685A)
Ref Sequence ENSEMBL: ENSMUSP00000003319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003319] [ENSMUST00000148679] [ENSMUST00000232680]
AlphaFold Q8K268
Predicted Effect probably damaging
Transcript: ENSMUST00000003319
AA Change: V685A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000003319
Gene: ENSMUSG00000003234
AA Change: V685A

DomainStartEndE-ValueType
low complexity region 120 137 N/A INTRINSIC
AAA 202 401 3.23e-11 SMART
low complexity region 423 435 N/A INTRINSIC
low complexity region 457 469 N/A INTRINSIC
AAA 517 684 4.68e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135861
Predicted Effect probably benign
Transcript: ENSMUST00000148679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154660
Predicted Effect probably benign
Transcript: ENSMUST00000231258
Predicted Effect probably benign
Transcript: ENSMUST00000232680
Meta Mutation Damage Score 0.4297 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd4 T C 14: 54,502,824 (GRCm39) Y44H probably damaging Het
AI429214 A G 8: 37,461,596 (GRCm39) D248G probably damaging Het
Aoc1l3 C T 6: 48,964,928 (GRCm39) P312L possibly damaging Het
AY358078 A G 14: 52,043,010 (GRCm39) T233A unknown Het
Calcr T C 6: 3,693,735 (GRCm39) Y353C probably damaging Het
Ccdc34 A G 2: 109,862,773 (GRCm39) K193E possibly damaging Het
Dhcr24 A G 4: 106,431,070 (GRCm39) E253G probably benign Het
Dnah6 A G 6: 73,104,910 (GRCm39) V1841A possibly damaging Het
Dpp10 A T 1: 123,413,653 (GRCm39) Y186* probably null Het
Dpysl4 C T 7: 138,680,851 (GRCm39) T575M probably damaging Het
Dusp7 T A 9: 106,251,092 (GRCm39) S406T probably benign Het
Gga3 T A 11: 115,478,368 (GRCm39) T475S probably benign Het
Gm10271 T A 10: 116,792,779 (GRCm39) K36* probably null Het
Gm572 G A 4: 148,753,329 (GRCm39) E325K possibly damaging Het
Golga2 A G 2: 32,195,623 (GRCm39) E806G probably benign Het
Igf1 A T 10: 87,751,181 (GRCm39) K126* probably null Het
Itpkc A T 7: 26,927,037 (GRCm39) N292K probably benign Het
Klhl1 A T 14: 96,517,641 (GRCm39) M345K probably benign Het
Lrp2 A G 2: 69,367,909 (GRCm39) V201A probably damaging Het
Lrrc8a C T 2: 30,151,972 (GRCm39) T757M probably benign Het
Mios T A 6: 8,216,453 (GRCm39) I459K probably benign Het
Mrps11 T C 7: 78,440,393 (GRCm39) I94T probably damaging Het
Ms4a4c T A 19: 11,393,759 (GRCm39) S68T probably benign Het
Mstn C T 1: 53,101,130 (GRCm39) T69I possibly damaging Het
Myo10 A G 15: 25,779,712 (GRCm39) K28E probably damaging Het
Nol6 A G 4: 41,117,452 (GRCm39) S914P probably damaging Het
Ntn1 C G 11: 68,276,619 (GRCm39) D110H probably damaging Het
Or51f1e T C 7: 102,747,391 (GRCm39) S148P probably damaging Het
Or52b4 C A 7: 102,184,487 (GRCm39) H178N probably benign Het
Pcdh17 C T 14: 84,684,699 (GRCm39) Q389* probably null Het
Pik3r2 G A 8: 71,223,065 (GRCm39) R452C probably benign Het
Prr14l T C 5: 32,987,689 (GRCm39) E602G probably damaging Het
Rusc2 C A 4: 43,416,424 (GRCm39) Q577K probably benign Het
Sacm1l T A 9: 123,416,641 (GRCm39) M534K probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slco4a1 C T 2: 180,105,884 (GRCm39) T22M probably benign Het
Tas2r104 A T 6: 131,661,888 (GRCm39) C274S probably benign Het
Tnrc6c C T 11: 117,614,355 (GRCm39) R838W probably damaging Het
Trim43c T A 9: 88,722,454 (GRCm39) H33Q probably damaging Het
Ttc17 A T 2: 94,199,758 (GRCm39) I411K possibly damaging Het
Ttn G T 2: 76,581,678 (GRCm39) L23072I possibly damaging Het
Ttn A C 2: 76,785,368 (GRCm39) V669G possibly damaging Het
Vmn1r60 A T 7: 5,548,026 (GRCm39) F25I possibly damaging Het
Vmn2r9 A G 5: 108,995,997 (GRCm39) I217T probably damaging Het
Other mutations in Abcf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Abcf3 APN 16 20,370,434 (GRCm39) missense probably damaging 0.98
IGL01570:Abcf3 APN 16 20,378,748 (GRCm39) missense probably damaging 1.00
IGL02239:Abcf3 APN 16 20,369,386 (GRCm39) missense possibly damaging 0.85
R0158:Abcf3 UTSW 16 20,371,316 (GRCm39) missense probably damaging 1.00
R0270:Abcf3 UTSW 16 20,378,918 (GRCm39) splice site probably null
R0579:Abcf3 UTSW 16 20,369,398 (GRCm39) missense probably benign
R0671:Abcf3 UTSW 16 20,369,237 (GRCm39) missense probably damaging 1.00
R0799:Abcf3 UTSW 16 20,378,084 (GRCm39) missense probably damaging 1.00
R1384:Abcf3 UTSW 16 20,378,053 (GRCm39) missense probably damaging 1.00
R1393:Abcf3 UTSW 16 20,379,180 (GRCm39) missense probably benign 0.01
R2356:Abcf3 UTSW 16 20,379,249 (GRCm39) missense probably benign 0.01
R2910:Abcf3 UTSW 16 20,378,982 (GRCm39) missense probably damaging 0.98
R2911:Abcf3 UTSW 16 20,378,982 (GRCm39) missense probably damaging 0.98
R3081:Abcf3 UTSW 16 20,378,114 (GRCm39) missense probably benign 0.09
R4707:Abcf3 UTSW 16 20,367,808 (GRCm39) missense possibly damaging 0.91
R4752:Abcf3 UTSW 16 20,369,326 (GRCm39) missense probably damaging 1.00
R4885:Abcf3 UTSW 16 20,370,425 (GRCm39) missense probably benign 0.05
R5672:Abcf3 UTSW 16 20,368,002 (GRCm39) missense probably benign 0.00
R5817:Abcf3 UTSW 16 20,367,833 (GRCm39) missense possibly damaging 0.95
R6013:Abcf3 UTSW 16 20,369,311 (GRCm39) splice site probably null
R6019:Abcf3 UTSW 16 20,371,201 (GRCm39) missense possibly damaging 0.60
R6026:Abcf3 UTSW 16 20,369,320 (GRCm39) missense probably damaging 1.00
R6952:Abcf3 UTSW 16 20,368,484 (GRCm39) splice site probably null
R7327:Abcf3 UTSW 16 20,367,430 (GRCm39) missense probably benign 0.03
R7431:Abcf3 UTSW 16 20,377,539 (GRCm39) missense probably benign 0.00
R7539:Abcf3 UTSW 16 20,371,382 (GRCm39) critical splice donor site probably null
R7764:Abcf3 UTSW 16 20,368,040 (GRCm39) missense probably benign 0.36
R8358:Abcf3 UTSW 16 20,367,796 (GRCm39) missense possibly damaging 0.95
R8391:Abcf3 UTSW 16 20,368,968 (GRCm39) missense possibly damaging 0.89
R8416:Abcf3 UTSW 16 20,369,023 (GRCm39) missense probably benign 0.02
R8821:Abcf3 UTSW 16 20,369,214 (GRCm39) missense probably damaging 1.00
R8831:Abcf3 UTSW 16 20,369,214 (GRCm39) missense probably damaging 1.00
R9005:Abcf3 UTSW 16 20,368,056 (GRCm39) missense probably benign
R9160:Abcf3 UTSW 16 20,379,246 (GRCm39) missense possibly damaging 0.93
R9501:Abcf3 UTSW 16 20,379,125 (GRCm39) missense probably damaging 1.00
X0066:Abcf3 UTSW 16 20,378,447 (GRCm39) missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CATTGAAGCTTTGGGCCAGG -3'
(R):5'- AATAAGGCTGTCCCCAAGTAG -3'

Sequencing Primer
(F):5'- GCTCTCAACAACTTCAGGGTGAG -3'
(R):5'- CCAAGTAGGGAAAGTCCTAAGCTTG -3'
Posted On 2015-04-06