Incidental Mutation 'R3853:Dsg4'
ID276036
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Namedesmoglein 4
Synonymslah, CDHF13
MMRRC Submission 040900-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.646) question?
Stock #R3853 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location20436175-20471821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20449234 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 79 (V79A)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
Predicted Effect probably benign
Transcript: ENSMUST00000019426
AA Change: V79A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: V79A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,346 H316L probably damaging Het
AI481877 T C 4: 59,047,390 N1410D possibly damaging Het
Cadps A G 14: 12,509,090 probably benign Het
Cluh A G 11: 74,656,453 D44G probably benign Het
Copb1 A G 7: 114,223,316 V726A probably damaging Het
Exo1 A T 1: 175,892,988 I291F probably benign Het
Eya4 C T 10: 23,116,676 A460T probably damaging Het
Gjc1 G T 11: 102,800,126 D350E probably benign Het
Hcar2 T C 5: 123,864,412 M343V probably benign Het
Ifna15 T C 4: 88,557,809 Y146C probably damaging Het
Lce3e C T 3: 92,967,832 Q32* probably null Het
Llgl1 T C 11: 60,707,249 L373P probably damaging Het
Mark2 A G 19: 7,277,290 C642R probably damaging Het
Mbd3l2 A G 9: 18,444,796 Q139R probably benign Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mum1l1 C T X: 139,236,654 probably null Het
Nynrin T A 14: 55,864,105 N410K probably benign Het
Olfr1243 A T 2: 89,527,573 M279K possibly damaging Het
Olfr1354 T A 10: 78,916,947 Y36N probably damaging Het
Olfr1466 A G 19: 13,342,498 T247A possibly damaging Het
Olfr906 G T 9: 38,488,951 R307S probably benign Het
Olfr978 A T 9: 39,994,154 T115S probably damaging Het
Padi3 T C 4: 140,791,269 probably benign Het
Prkce A G 17: 86,168,849 D86G probably damaging Het
Rad21 T G 15: 51,972,316 I234L probably benign Het
Scn4a A T 11: 106,320,106 M1695K possibly damaging Het
Sdccag8 T C 1: 176,853,795 S325P probably damaging Het
Sebox G A 11: 78,504,149 G106R probably benign Het
Serpinb9 A G 13: 33,015,520 E266G possibly damaging Het
Snx14 T C 9: 88,407,319 probably benign Het
Tmc6 A T 11: 117,773,058 L474* probably null Het
Tmem132c T C 5: 127,359,869 Y141H probably benign Het
Trap1 G A 16: 4,054,822 R328C possibly damaging Het
Trim36 C A 18: 46,172,372 probably benign Het
Trmt2a A T 16: 18,251,191 Y299F possibly damaging Het
Trrap A G 5: 144,792,165 K630E probably damaging Het
Tsnaxip1 A T 8: 105,840,701 probably benign Het
Ttc6 G T 12: 57,728,549 C1677F possibly damaging Het
Ugt2a3 A T 5: 87,337,159 V2D possibly damaging Het
Usp9x A G X: 13,098,583 D77G probably benign Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zan A C 5: 137,474,064 L140R probably damaging Het
Zc3h3 A T 15: 75,837,497 S508T probably benign Het
Zswim3 A G 2: 164,820,857 Y419C possibly damaging Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20461326 missense probably benign 0.22
IGL01723:Dsg4 APN 18 20466510 missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20461304 missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20446250 splice site probably benign
IGL02553:Dsg4 APN 18 20462520 missense probably benign
IGL02578:Dsg4 APN 18 20471193 missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20458580 missense probably benign 0.01
IGL02677:Dsg4 APN 18 20464876 missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20471496 missense probably benign
IGL02747:Dsg4 APN 18 20446938 missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20451823 missense probably damaging 1.00
burrito UTSW 18 20451862 missense possibly damaging 0.81
R0043:Dsg4 UTSW 18 20452972 missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20470879 missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20458571 missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20461359 missense probably benign 0.00
R0622:Dsg4 UTSW 18 20449788 missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20454646 splice site probably benign
R0786:Dsg4 UTSW 18 20449372 critical splice donor site probably null
R1114:Dsg4 UTSW 18 20466483 missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20446872 nonsense probably null
R1372:Dsg4 UTSW 18 20449676 splice site probably null
R1382:Dsg4 UTSW 18 20465124 missense probably benign 0.00
R1392:Dsg4 UTSW 18 20446247 splice site probably benign
R1442:Dsg4 UTSW 18 20462660 missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20449679 missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20471589 missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20462461 nonsense probably null
R1765:Dsg4 UTSW 18 20456831 missense probably benign 0.01
R1817:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20471212 missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20466636 nonsense probably null
R2097:Dsg4 UTSW 18 20471044 missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20461442 missense probably benign
R3551:Dsg4 UTSW 18 20451756 missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20471001 missense probably damaging 1.00
R3955:Dsg4 UTSW 18 20449375 splice site probably null
R4006:Dsg4 UTSW 18 20470965 missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20451862 missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20458579 nonsense probably null
R4254:Dsg4 UTSW 18 20471538 missense probably benign 0.07
R4504:Dsg4 UTSW 18 20461436 missense probably benign 0.00
R4559:Dsg4 UTSW 18 20470921 missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20462413 missense probably benign 0.10
R4683:Dsg4 UTSW 18 20461409 missense probably benign
R4700:Dsg4 UTSW 18 20456908 missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20446831 missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20471127 missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20466621 missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20446839 missense probably benign 0.21
R5426:Dsg4 UTSW 18 20458484 missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20462492 nonsense probably null
R5982:Dsg4 UTSW 18 20465169 missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20466667 missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20449790 missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20471363 missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20458521 missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20451852 missense probably benign 0.01
R7196:Dsg4 UTSW 18 20466480 missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20446266 nonsense probably null
R7438:Dsg4 UTSW 18 20466628 missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20451936 intron probably null
R7612:Dsg4 UTSW 18 20470990 missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20449712 missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
R7988:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACATGCATGCACAAGTG -3'
(R):5'- CATAAACAGGTGTAGTACATGGGAC -3'

Sequencing Primer
(F):5'- GTGCACACACACACACAC -3'
(R):5'- GGGACACCAACTTAGCTCCTTCAG -3'
Posted On2015-04-06