Incidental Mutation 'R3854:Dnajc16'
ID276052
Institutional Source Beutler Lab
Gene Symbol Dnajc16
Ensembl Gene ENSMUSG00000040697
Gene NameDnaJ heat shock protein family (Hsp40) member C16
Synonyms4732437J24Rik, 2900037O03Rik
MMRRC Submission 041605-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.520) question?
Stock #R3854 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location141760189-141790931 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 141763653 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 729 (R729*)
Ref Sequence ENSEMBL: ENSMUSP00000048714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038014] [ENSMUST00000038161]
PDB Structure Solution structure of the J domain of the pseudo DnaJ protein, mouse hypothetical mKIAA0962 [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000038014
AA Change: R729*
SMART Domains Protein: ENSMUSP00000048714
Gene: ENSMUSG00000040697
AA Change: R729*

DomainStartEndE-ValueType
DnaJ 28 85 4.5e-30 SMART
Pfam:Thioredoxin 142 243 4.4e-8 PFAM
low complexity region 537 549 N/A INTRINSIC
low complexity region 730 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038161
SMART Domains Protein: ENSMUSP00000040853
Gene: ENSMUSG00000040706

DomainStartEndE-ValueType
low complexity region 44 62 N/A INTRINSIC
Pfam:Arginase 77 351 9.8e-85 PFAM
Meta Mutation Damage Score 0.9712 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.2%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1 T C 2: 58,462,934 K338R probably damaging Het
Adar C T 3: 89,736,258 P482L probably damaging Het
Adh5 A G 3: 138,451,015 D154G probably benign Het
Apoa1 A G 9: 46,230,223 S206G probably benign Het
Aspdh T C 7: 44,466,189 V5A possibly damaging Het
Bend3 AAGGACCA AA 10: 43,510,717 probably benign Het
C2cd3 A T 7: 100,454,601 probably null Het
Ccdc87 A G 19: 4,839,518 I13V probably benign Het
Cd163 A T 6: 124,311,566 N319Y probably damaging Het
Cdc42bpa A G 1: 180,155,978 probably benign Het
Ceacam2 T C 7: 25,538,802 S66G probably benign Het
Cep131 G A 11: 120,067,185 R772* probably null Het
Clhc1 T C 11: 29,571,789 C441R probably damaging Het
Clstn2 G A 9: 97,463,595 Q567* probably null Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Daam2 T C 17: 49,458,596 N1093S probably benign Het
Dscr3 A G 16: 94,510,806 F95L probably benign Het
Eml6 C T 11: 29,749,905 A1744T possibly damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fbll1 T A 11: 35,797,699 T246S probably benign Het
Fbln2 A T 6: 91,266,371 T910S probably damaging Het
Fcna C T 2: 25,627,772 G22D possibly damaging Het
Gadl1 G T 9: 116,006,664 E387* probably null Het
Gm5592 G A 7: 41,157,835 probably benign Het
Gpr82 A T X: 13,665,338 T42S probably benign Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Lbr G A 1: 181,831,715 T167I probably benign Het
Mdh1 C T 11: 21,559,281 V234I probably benign Het
Muc2 A G 7: 141,754,344 H420R probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nrcam G T 12: 44,575,884 A938S probably benign Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Olfr406 A T 11: 74,270,279 K297* probably null Het
Olfr419 T A 1: 174,250,150 Y259F probably damaging Het
Olfr550 T G 7: 102,579,020 L175R probably damaging Het
Pgap3 T C 11: 98,390,812 T187A possibly damaging Het
Pus10 T C 11: 23,703,003 probably null Het
Rnf213 T C 11: 119,480,939 probably benign Het
Sag T C 1: 87,824,518 probably benign Het
Serpinb9e A G 13: 33,255,154 I188V probably benign Het
Shcbp1l A T 1: 153,452,444 I634F probably damaging Het
Slc6a16 T A 7: 45,268,172 C485S probably damaging Het
Vmn1r215 A C 13: 23,075,888 M33L probably benign Het
Other mutations in Dnajc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dnajc16 APN 4 141763563 splice site probably null
IGL00840:Dnajc16 APN 4 141768003 missense probably damaging 1.00
IGL01503:Dnajc16 APN 4 141763697 missense possibly damaging 0.65
IGL01919:Dnajc16 APN 4 141774629 missense probably benign 0.06
IGL02065:Dnajc16 APN 4 141776933 missense probably damaging 1.00
IGL02544:Dnajc16 APN 4 141764647 missense probably damaging 1.00
IGL03028:Dnajc16 APN 4 141767732 nonsense probably null
PIT4418001:Dnajc16 UTSW 4 141770949 missense probably damaging 0.99
PIT4585001:Dnajc16 UTSW 4 141764685 missense probably damaging 1.00
R0071:Dnajc16 UTSW 4 141768007 missense probably benign
R0415:Dnajc16 UTSW 4 141789048 nonsense probably null
R0532:Dnajc16 UTSW 4 141789009 missense probably damaging 1.00
R1418:Dnajc16 UTSW 4 141767741 nonsense probably null
R2959:Dnajc16 UTSW 4 141766545 nonsense probably null
R3025:Dnajc16 UTSW 4 141774611 missense probably benign
R3796:Dnajc16 UTSW 4 141767737 missense probably benign
R3856:Dnajc16 UTSW 4 141763653 nonsense probably null
R4661:Dnajc16 UTSW 4 141763548 missense probably damaging 1.00
R4841:Dnajc16 UTSW 4 141774625 missense probably damaging 1.00
R4842:Dnajc16 UTSW 4 141774625 missense probably damaging 1.00
R5116:Dnajc16 UTSW 4 141767969 nonsense probably null
R5126:Dnajc16 UTSW 4 141774509 missense probably benign 0.01
R5140:Dnajc16 UTSW 4 141764683 missense possibly damaging 0.85
R5275:Dnajc16 UTSW 4 141767928 missense possibly damaging 0.82
R5295:Dnajc16 UTSW 4 141767928 missense possibly damaging 0.82
R5891:Dnajc16 UTSW 4 141775392 missense probably benign
R6888:Dnajc16 UTSW 4 141776992 missense probably benign 0.24
R7062:Dnajc16 UTSW 4 141766690 missense probably damaging 1.00
R7441:Dnajc16 UTSW 4 141763813 missense probably damaging 1.00
R7684:Dnajc16 UTSW 4 141774568 missense probably benign 0.02
R8843:Dnajc16 UTSW 4 141764691 missense possibly damaging 0.87
R8924:Dnajc16 UTSW 4 141766707 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTAAAATCCCTGTTCCTGGGG -3'
(R):5'- TCCTTCCTGACACTGGACAAAC -3'

Sequencing Primer
(F):5'- GCCCGCTATCCTCTGGAG -3'
(R):5'- TGACACTGGACAAACACCGGG -3'
Posted On2015-04-06