Incidental Mutation 'R3854:Dnajc16'
ID 276052
Institutional Source Beutler Lab
Gene Symbol Dnajc16
Ensembl Gene ENSMUSG00000040697
Gene Name DnaJ heat shock protein family (Hsp40) member C16
Synonyms 2900037O03Rik, 4732437J24Rik
MMRRC Submission 041605-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.724) question?
Stock # R3854 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 141487500-141518242 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 141490964 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 729 (R729*)
Ref Sequence ENSEMBL: ENSMUSP00000048714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038014] [ENSMUST00000038161]
AlphaFold Q80TN4
PDB Structure Solution structure of the J domain of the pseudo DnaJ protein, mouse hypothetical mKIAA0962 [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000038014
AA Change: R729*
SMART Domains Protein: ENSMUSP00000048714
Gene: ENSMUSG00000040697
AA Change: R729*

DomainStartEndE-ValueType
DnaJ 28 85 4.5e-30 SMART
Pfam:Thioredoxin 142 243 4.4e-8 PFAM
low complexity region 537 549 N/A INTRINSIC
low complexity region 730 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038161
SMART Domains Protein: ENSMUSP00000040853
Gene: ENSMUSG00000040706

DomainStartEndE-ValueType
low complexity region 44 62 N/A INTRINSIC
Pfam:Arginase 77 351 9.8e-85 PFAM
Meta Mutation Damage Score 0.9712 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.2%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1 T C 2: 58,352,946 (GRCm39) K338R probably damaging Het
Adar C T 3: 89,643,565 (GRCm39) P482L probably damaging Het
Adh5 A G 3: 138,156,776 (GRCm39) D154G probably benign Het
Apoa1 A G 9: 46,141,521 (GRCm39) S206G probably benign Het
Aspdh T C 7: 44,115,613 (GRCm39) V5A possibly damaging Het
Bend3 AAGGACCA AA 10: 43,386,713 (GRCm39) probably benign Het
C2cd3 A T 7: 100,103,808 (GRCm39) probably null Het
Ccdc87 A G 19: 4,889,546 (GRCm39) I13V probably benign Het
Cd163 A T 6: 124,288,525 (GRCm39) N319Y probably damaging Het
Cdc42bpa A G 1: 179,983,543 (GRCm39) probably benign Het
Ceacam2 T C 7: 25,238,227 (GRCm39) S66G probably benign Het
Cep131 G A 11: 119,958,011 (GRCm39) R772* probably null Het
Clhc1 T C 11: 29,521,789 (GRCm39) C441R probably damaging Het
Clstn2 G A 9: 97,345,648 (GRCm39) Q567* probably null Het
Cops7a C T 6: 124,936,795 (GRCm39) R252H probably damaging Het
Daam2 T C 17: 49,765,624 (GRCm39) N1093S probably benign Het
Eml6 C T 11: 29,699,905 (GRCm39) A1744T possibly damaging Het
Fam43b G C 4: 138,122,409 (GRCm39) R304G probably benign Het
Fbll1 T A 11: 35,688,526 (GRCm39) T246S probably benign Het
Fbln2 A T 6: 91,243,353 (GRCm39) T910S probably damaging Het
Fcna C T 2: 25,517,784 (GRCm39) G22D possibly damaging Het
Gadl1 G T 9: 115,835,732 (GRCm39) E387* probably null Het
Gm5592 G A 7: 40,807,259 (GRCm39) probably benign Het
Gpr82 A T X: 13,531,577 (GRCm39) T42S probably benign Het
Hk2 T C 6: 82,713,657 (GRCm39) E447G possibly damaging Het
Idi1 G T 13: 8,935,968 (GRCm39) A25S probably benign Het
Lbr G A 1: 181,659,280 (GRCm39) T167I probably benign Het
Mdh1 C T 11: 21,509,281 (GRCm39) V234I probably benign Het
Muc2 A G 7: 141,308,081 (GRCm39) H420R probably damaging Het
Nhlrc2 T C 19: 56,576,703 (GRCm39) probably null Het
Nrcam G T 12: 44,622,667 (GRCm39) A938S probably benign Het
Nt5c2 A G 19: 46,884,957 (GRCm39) V252A probably damaging Het
Or10z1 T A 1: 174,077,716 (GRCm39) Y259F probably damaging Het
Or1p1c A T 11: 74,161,105 (GRCm39) K297* probably null Het
Or51r1 T G 7: 102,228,227 (GRCm39) L175R probably damaging Het
Pgap3 T C 11: 98,281,638 (GRCm39) T187A possibly damaging Het
Pus10 T C 11: 23,653,003 (GRCm39) probably null Het
Rnf213 T C 11: 119,371,765 (GRCm39) probably benign Het
Sag T C 1: 87,752,240 (GRCm39) probably benign Het
Serpinb9e A G 13: 33,439,137 (GRCm39) I188V probably benign Het
Shcbp1l A T 1: 153,328,190 (GRCm39) I634F probably damaging Het
Slc6a16 T A 7: 44,917,596 (GRCm39) C485S probably damaging Het
Vmn1r215 A C 13: 23,260,058 (GRCm39) M33L probably benign Het
Vps26c A G 16: 94,311,665 (GRCm39) F95L probably benign Het
Other mutations in Dnajc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dnajc16 APN 4 141,490,874 (GRCm39) splice site probably null
IGL00840:Dnajc16 APN 4 141,495,314 (GRCm39) missense probably damaging 1.00
IGL01503:Dnajc16 APN 4 141,491,008 (GRCm39) missense possibly damaging 0.65
IGL01919:Dnajc16 APN 4 141,501,940 (GRCm39) missense probably benign 0.06
IGL02065:Dnajc16 APN 4 141,504,244 (GRCm39) missense probably damaging 1.00
IGL02544:Dnajc16 APN 4 141,491,958 (GRCm39) missense probably damaging 1.00
IGL03028:Dnajc16 APN 4 141,495,043 (GRCm39) nonsense probably null
PIT4418001:Dnajc16 UTSW 4 141,498,260 (GRCm39) missense probably damaging 0.99
PIT4585001:Dnajc16 UTSW 4 141,491,996 (GRCm39) missense probably damaging 1.00
R0071:Dnajc16 UTSW 4 141,495,318 (GRCm39) missense probably benign
R0415:Dnajc16 UTSW 4 141,516,359 (GRCm39) nonsense probably null
R0532:Dnajc16 UTSW 4 141,516,320 (GRCm39) missense probably damaging 1.00
R1418:Dnajc16 UTSW 4 141,495,052 (GRCm39) nonsense probably null
R2959:Dnajc16 UTSW 4 141,493,856 (GRCm39) nonsense probably null
R3025:Dnajc16 UTSW 4 141,501,922 (GRCm39) missense probably benign
R3796:Dnajc16 UTSW 4 141,495,048 (GRCm39) missense probably benign
R3856:Dnajc16 UTSW 4 141,490,964 (GRCm39) nonsense probably null
R4661:Dnajc16 UTSW 4 141,490,859 (GRCm39) missense probably damaging 1.00
R4841:Dnajc16 UTSW 4 141,501,936 (GRCm39) missense probably damaging 1.00
R4842:Dnajc16 UTSW 4 141,501,936 (GRCm39) missense probably damaging 1.00
R5116:Dnajc16 UTSW 4 141,495,280 (GRCm39) nonsense probably null
R5126:Dnajc16 UTSW 4 141,501,820 (GRCm39) missense probably benign 0.01
R5140:Dnajc16 UTSW 4 141,491,994 (GRCm39) missense possibly damaging 0.85
R5275:Dnajc16 UTSW 4 141,495,239 (GRCm39) missense possibly damaging 0.82
R5295:Dnajc16 UTSW 4 141,495,239 (GRCm39) missense possibly damaging 0.82
R5891:Dnajc16 UTSW 4 141,502,703 (GRCm39) missense probably benign
R6888:Dnajc16 UTSW 4 141,504,303 (GRCm39) missense probably benign 0.24
R7062:Dnajc16 UTSW 4 141,494,001 (GRCm39) missense probably damaging 1.00
R7441:Dnajc16 UTSW 4 141,491,124 (GRCm39) missense probably damaging 1.00
R7684:Dnajc16 UTSW 4 141,501,879 (GRCm39) missense probably benign 0.02
R8843:Dnajc16 UTSW 4 141,492,002 (GRCm39) missense possibly damaging 0.87
R8924:Dnajc16 UTSW 4 141,494,018 (GRCm39) nonsense probably null
R9005:Dnajc16 UTSW 4 141,491,945 (GRCm39) missense possibly damaging 0.95
R9053:Dnajc16 UTSW 4 141,510,371 (GRCm39) missense probably benign 0.28
R9550:Dnajc16 UTSW 4 141,495,058 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTAAAATCCCTGTTCCTGGGG -3'
(R):5'- TCCTTCCTGACACTGGACAAAC -3'

Sequencing Primer
(F):5'- GCCCGCTATCCTCTGGAG -3'
(R):5'- TGACACTGGACAAACACCGGG -3'
Posted On 2015-04-06