Mutagenetix > Incidental Mutations

Incidental Mutation 'R3854:Dnajc16'

276052

Institutional Source

Beutler Lab

Gene Symbol

Dnajc16

Ensembl Gene

ENSMUSG00000040697

Gene Name

DnaJ heat shock protein family (Hsp40) member C16

Synonyms

4732437J24Rik, 2900037O03Rik

MMRRC Submission

041605-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.520) question?

Stock #

R3854 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

141760189-141790931 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 141763653 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 729 (R729*)

Ref Sequence

ENSEMBL: ENSMUSP00000048714 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038014] [ENSMUST00000038161]

PDB Structure

Solution structure of the J domain of the pseudo DnaJ protein, mouse hypothetical mKIAA0962 [SOLUTION NMR]

Predicted Effect

probably null
Transcript: ENSMUST00000038014
AA Change: R729*

SMART Domains

Protein: ENSMUSP00000048714
Gene: ENSMUSG00000040697
AA Change: R729*

Domain	Start	End	E-Value	Type
DnaJ	28	85	4.5e-30	SMART
Pfam:Thioredoxin	142	243	4.4e-8	PFAM
low complexity region	537	549	N/A	INTRINSIC
low complexity region	730	750	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000038161

SMART Domains

Protein: ENSMUSP00000040853
Gene: ENSMUSG00000040706

Domain	Start	End	E-Value	Type
low complexity region	44	62	N/A	INTRINSIC
Pfam:Arginase	77	351	9.8e-85	PFAM

Meta Mutation Damage Score

0.9712

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 97.2%
20x: 94.2%

Validation Efficiency

96% (46/48)

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acvr1	T	C	2: 58,462,934	K338R	probably damaging	Het
Adar	C	T	3: 89,736,258	P482L	probably damaging	Het
Adh5	A	G	3: 138,451,015	D154G	probably benign	Het
Apoa1	A	G	9: 46,230,223	S206G	probably benign	Het
Aspdh	T	C	7: 44,466,189	V5A	possibly damaging	Het
Bend3	AAGGACCA	AA	10: 43,510,717		probably benign	Het
C2cd3	A	T	7: 100,454,601		probably null	Het
Ccdc87	A	G	19: 4,839,518	I13V	probably benign	Het
Cd163	A	T	6: 124,311,566	N319Y	probably damaging	Het
Cdc42bpa	A	G	1: 180,155,978		probably benign	Het
Ceacam2	T	C	7: 25,538,802	S66G	probably benign	Het
Cep131	G	A	11: 120,067,185	R772*	probably null	Het
Clhc1	T	C	11: 29,571,789	C441R	probably damaging	Het
Clstn2	G	A	9: 97,463,595	Q567*	probably null	Het
Cops7a	C	T	6: 124,959,832	R252H	probably damaging	Het
Daam2	T	C	17: 49,458,596	N1093S	probably benign	Het
Dscr3	A	G	16: 94,510,806	F95L	probably benign	Het
Eml6	C	T	11: 29,749,905	A1744T	possibly damaging	Het
Fam43b	G	C	4: 138,395,098	R304G	probably benign	Het
Fbll1	T	A	11: 35,797,699	T246S	probably benign	Het
Fbln2	A	T	6: 91,266,371	T910S	probably damaging	Het
Fcna	C	T	2: 25,627,772	G22D	possibly damaging	Het
Gadl1	G	T	9: 116,006,664	E387*	probably null	Het
Gm5592	G	A	7: 41,157,835		probably benign	Het
Gpr82	A	T	X: 13,665,338	T42S	probably benign	Het
Hk2	T	C	6: 82,736,676	E447G	possibly damaging	Het
Idi1	G	T	13: 8,885,932	A25S	probably benign	Het
Lbr	G	A	1: 181,831,715	T167I	probably benign	Het
Mdh1	C	T	11: 21,559,281	V234I	probably benign	Het
Muc2	A	G	7: 141,754,344	H420R	probably damaging	Het
Nhlrc2	T	C	19: 56,588,271		probably null	Het
Nrcam	G	T	12: 44,575,884	A938S	probably benign	Het
Nt5c2	A	G	19: 46,896,518	V252A	probably damaging	Het
Olfr406	A	T	11: 74,270,279	K297*	probably null	Het
Olfr419	T	A	1: 174,250,150	Y259F	probably damaging	Het
Olfr550	T	G	7: 102,579,020	L175R	probably damaging	Het
Pgap3	T	C	11: 98,390,812	T187A	possibly damaging	Het
Pus10	T	C	11: 23,703,003		probably null	Het
Rnf213	T	C	11: 119,480,939		probably benign	Het
Sag	T	C	1: 87,824,518		probably benign	Het
Serpinb9e	A	G	13: 33,255,154	I188V	probably benign	Het
Shcbp1l	A	T	1: 153,452,444	I634F	probably damaging	Het
Slc6a16	T	A	7: 45,268,172	C485S	probably damaging	Het
Vmn1r215	A	C	13: 23,075,888	M33L	probably benign	Het

Other mutations in Dnajc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00495:Dnajc16	APN	4	141763563	splice site	probably null
IGL00840:Dnajc16	APN	4	141768003	missense	probably damaging	1.00
IGL01503:Dnajc16	APN	4	141763697	missense	possibly damaging	0.65
IGL01919:Dnajc16	APN	4	141774629	missense	probably benign	0.06
IGL02065:Dnajc16	APN	4	141776933	missense	probably damaging	1.00
IGL02544:Dnajc16	APN	4	141764647	missense	probably damaging	1.00
IGL03028:Dnajc16	APN	4	141767732	nonsense	probably null
PIT4418001:Dnajc16	UTSW	4	141770949	missense	probably damaging	0.99
PIT4585001:Dnajc16	UTSW	4	141764685	missense	probably damaging	1.00
R0071:Dnajc16	UTSW	4	141768007	missense	probably benign
R0415:Dnajc16	UTSW	4	141789048	nonsense	probably null
R0532:Dnajc16	UTSW	4	141789009	missense	probably damaging	1.00
R1418:Dnajc16	UTSW	4	141767741	nonsense	probably null
R2959:Dnajc16	UTSW	4	141766545	nonsense	probably null
R3025:Dnajc16	UTSW	4	141774611	missense	probably benign
R3796:Dnajc16	UTSW	4	141767737	missense	probably benign
R3856:Dnajc16	UTSW	4	141763653	nonsense	probably null
R4661:Dnajc16	UTSW	4	141763548	missense	probably damaging	1.00
R4841:Dnajc16	UTSW	4	141774625	missense	probably damaging	1.00
R4842:Dnajc16	UTSW	4	141774625	missense	probably damaging	1.00
R5116:Dnajc16	UTSW	4	141767969	nonsense	probably null
R5126:Dnajc16	UTSW	4	141774509	missense	probably benign	0.01
R5140:Dnajc16	UTSW	4	141764683	missense	possibly damaging	0.85
R5275:Dnajc16	UTSW	4	141767928	missense	possibly damaging	0.82
R5295:Dnajc16	UTSW	4	141767928	missense	possibly damaging	0.82
R5891:Dnajc16	UTSW	4	141775392	missense	probably benign
R6888:Dnajc16	UTSW	4	141776992	missense	probably benign	0.24
R7062:Dnajc16	UTSW	4	141766690	missense	probably damaging	1.00
R7441:Dnajc16	UTSW	4	141763813	missense	probably damaging	1.00
R7684:Dnajc16	UTSW	4	141774568	missense	probably benign	0.02
R8843:Dnajc16	UTSW	4	141764691	missense	possibly damaging	0.87
R8924:Dnajc16	UTSW	4	141766707	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTAAAATCCCTGTTCCTGGGG -3'
(R):5'- TCCTTCCTGACACTGGACAAAC -3'

Sequencing Primer
(F):5'- GCCCGCTATCCTCTGGAG -3'
(R):5'- TGACACTGGACAAACACCGGG -3'

Posted On

2015-04-06