Incidental Mutation 'R3854:Gadl1'
ID276067
Institutional Source Beutler Lab
Gene Symbol Gadl1
Ensembl Gene ENSMUSG00000056880
Gene Nameglutamate decarboxylase-like 1
Synonyms
MMRRC Submission 041605-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R3854 (G1)
Quality Score220
Status Validated
Chromosome9
Chromosomal Location115909455-116076176 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 116006664 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 387 (E387*)
Ref Sequence ENSEMBL: ENSMUSP00000113240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069651] [ENSMUST00000119291] [ENSMUST00000121770]
Predicted Effect probably null
Transcript: ENSMUST00000069651
AA Change: E387*
SMART Domains Protein: ENSMUSP00000077694
Gene: ENSMUSG00000056880
AA Change: E387*

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 58 426 1.1e-113 PFAM
Pfam:Beta_elim_lyase 137 467 1e-7 PFAM
Pfam:Aminotran_5 167 333 1.6e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119291
AA Change: E387*
SMART Domains Protein: ENSMUSP00000112433
Gene: ENSMUSG00000056880
AA Change: E387*

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 58 426 3.2e-112 PFAM
Pfam:Beta_elim_lyase 137 446 1.6e-6 PFAM
Pfam:Aminotran_5 184 330 3.3e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121770
AA Change: E387*
SMART Domains Protein: ENSMUSP00000113240
Gene: ENSMUSG00000056880
AA Change: E387*

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 58 426 2.8e-112 PFAM
Pfam:Beta_elim_lyase 137 461 6.2e-8 PFAM
Pfam:Aminotran_5 184 330 4.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130584
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.2%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1 T C 2: 58,462,934 K338R probably damaging Het
Adar C T 3: 89,736,258 P482L probably damaging Het
Adh5 A G 3: 138,451,015 D154G probably benign Het
Apoa1 A G 9: 46,230,223 S206G probably benign Het
Aspdh T C 7: 44,466,189 V5A possibly damaging Het
Bend3 AAGGACCA AA 10: 43,510,717 probably benign Het
C2cd3 A T 7: 100,454,601 probably null Het
Ccdc87 A G 19: 4,839,518 I13V probably benign Het
Cd163 A T 6: 124,311,566 N319Y probably damaging Het
Cdc42bpa A G 1: 180,155,978 probably benign Het
Ceacam2 T C 7: 25,538,802 S66G probably benign Het
Cep131 G A 11: 120,067,185 R772* probably null Het
Clhc1 T C 11: 29,571,789 C441R probably damaging Het
Clstn2 G A 9: 97,463,595 Q567* probably null Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Daam2 T C 17: 49,458,596 N1093S probably benign Het
Dnajc16 G A 4: 141,763,653 R729* probably null Het
Dscr3 A G 16: 94,510,806 F95L probably benign Het
Eml6 C T 11: 29,749,905 A1744T possibly damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fbll1 T A 11: 35,797,699 T246S probably benign Het
Fbln2 A T 6: 91,266,371 T910S probably damaging Het
Fcna C T 2: 25,627,772 G22D possibly damaging Het
Gm5592 G A 7: 41,157,835 probably benign Het
Gpr82 A T X: 13,665,338 T42S probably benign Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Lbr G A 1: 181,831,715 T167I probably benign Het
Mdh1 C T 11: 21,559,281 V234I probably benign Het
Muc2 A G 7: 141,754,344 H420R probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nrcam G T 12: 44,575,884 A938S probably benign Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Olfr406 A T 11: 74,270,279 K297* probably null Het
Olfr419 T A 1: 174,250,150 Y259F probably damaging Het
Olfr550 T G 7: 102,579,020 L175R probably damaging Het
Pgap3 T C 11: 98,390,812 T187A possibly damaging Het
Pus10 T C 11: 23,703,003 probably null Het
Rnf213 T C 11: 119,480,939 probably benign Het
Sag T C 1: 87,824,518 probably benign Het
Serpinb9e A G 13: 33,255,154 I188V probably benign Het
Shcbp1l A T 1: 153,452,444 I634F probably damaging Het
Slc6a16 T A 7: 45,268,172 C485S probably damaging Het
Vmn1r215 A C 13: 23,075,888 M33L probably benign Het
Other mutations in Gadl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Gadl1 APN 9 115954839 critical splice donor site probably null
IGL01343:Gadl1 APN 9 116074112 makesense probably null
IGL01693:Gadl1 APN 9 115949585 missense probably damaging 1.00
IGL02106:Gadl1 APN 9 115937157 utr 5 prime probably benign
IGL02740:Gadl1 APN 9 116006561 nonsense probably null
IGL03063:Gadl1 APN 9 115966267 missense probably damaging 1.00
IGL03104:Gadl1 APN 9 116074040 missense possibly damaging 0.93
IGL03127:Gadl1 APN 9 115948664 missense probably damaging 1.00
R0133:Gadl1 UTSW 9 115941343 missense probably benign 0.00
R0285:Gadl1 UTSW 9 116030738 splice site probably benign
R0737:Gadl1 UTSW 9 116073987 missense probably damaging 0.99
R0771:Gadl1 UTSW 9 115944232 missense probably damaging 1.00
R1522:Gadl1 UTSW 9 115944229 missense probably damaging 1.00
R1716:Gadl1 UTSW 9 116006508 nonsense probably null
R2061:Gadl1 UTSW 9 115941380 missense probably damaging 1.00
R2163:Gadl1 UTSW 9 115949558 missense possibly damaging 0.93
R3964:Gadl1 UTSW 9 115965608 missense probably damaging 0.98
R4654:Gadl1 UTSW 9 115941340 missense probably damaging 1.00
R4724:Gadl1 UTSW 9 115954617 missense possibly damaging 0.81
R4765:Gadl1 UTSW 9 115966313 missense probably null 0.00
R4956:Gadl1 UTSW 9 116040919 missense probably benign 0.00
R5179:Gadl1 UTSW 9 115960380 nonsense probably null
R5593:Gadl1 UTSW 9 116006650 missense probably damaging 1.00
R5620:Gadl1 UTSW 9 115937162 start codon destroyed probably benign 0.09
R6048:Gadl1 UTSW 9 116006701 splice site probably null
R6458:Gadl1 UTSW 9 116041002 makesense probably null
R7497:Gadl1 UTSW 9 116074087 missense probably benign 0.00
R7889:Gadl1 UTSW 9 115954815 missense possibly damaging 0.56
Z1088:Gadl1 UTSW 9 115937270 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTTAAAGTGAATGGGCTCAGC -3'
(R):5'- CATTGTGTGCAAGAAGGAACTC -3'

Sequencing Primer
(F):5'- GGCTCAGCCTCTCTCCTTTC -3'
(R):5'- GTATGTATGGAATCTACCAATGCTC -3'
Posted On2015-04-06