Incidental Mutation 'R3854:Mdh1'
ID276070
Institutional Source Beutler Lab
Gene Symbol Mdh1
Ensembl Gene ENSMUSG00000020321
Gene Namemalate dehydrogenase 1, NAD (soluble)
SynonymsMor2, MDH-s, Mor-2, B230377B03Rik
MMRRC Submission 041605-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3854 (G1)
Quality Score182
Status Validated
Chromosome11
Chromosomal Location21556787-21572367 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21559281 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 234 (V234I)
Ref Sequence ENSEMBL: ENSMUSP00000099938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102874] [ENSMUST00000125302]
Predicted Effect probably benign
Transcript: ENSMUST00000102874
AA Change: V234I

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099938
Gene: ENSMUSG00000020321
AA Change: V234I

DomainStartEndE-ValueType
Pfam:Ldh_1_N 5 153 7.3e-41 PFAM
Pfam:Ldh_1_C 156 331 1.2e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125302
SMART Domains Protein: ENSMUSP00000119816
Gene: ENSMUSG00000020321

DomainStartEndE-ValueType
Pfam:Ldh_1_N 5 153 5e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146146
Meta Mutation Damage Score 0.1553 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.2%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: This gene encodes an enzyme that catalyzes the NAD/NADH-dependent, reversible oxidation of malate to oxaloacetate in many metabolic pathways, including the citric acid cycle. Two main isozymes are known to exist in eukaryotic cells: one is found in the mitochondrial matrix and the other in the cytoplasm. This gene encodes the cytosolic isozyme, which plays a key role in the malate-aspartate shuttle that allows malate to pass through the mitochondrial membrane to be transformed into oxaloacetate for further cellular processes. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is localized in the peroxisomes. A pseudogene has been identified on chromosomes 12. [provided by RefSeq, Feb 2016]
PHENOTYPE: An ENU-induced mutation results in prenatal lethality in homozygotes and decreased enzyme activity in heterozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1 T C 2: 58,462,934 K338R probably damaging Het
Adar C T 3: 89,736,258 P482L probably damaging Het
Adh5 A G 3: 138,451,015 D154G probably benign Het
Apoa1 A G 9: 46,230,223 S206G probably benign Het
Aspdh T C 7: 44,466,189 V5A possibly damaging Het
Bend3 AAGGACCA AA 10: 43,510,717 probably benign Het
C2cd3 A T 7: 100,454,601 probably null Het
Ccdc87 A G 19: 4,839,518 I13V probably benign Het
Cd163 A T 6: 124,311,566 N319Y probably damaging Het
Cdc42bpa A G 1: 180,155,978 probably benign Het
Ceacam2 T C 7: 25,538,802 S66G probably benign Het
Cep131 G A 11: 120,067,185 R772* probably null Het
Clhc1 T C 11: 29,571,789 C441R probably damaging Het
Clstn2 G A 9: 97,463,595 Q567* probably null Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Daam2 T C 17: 49,458,596 N1093S probably benign Het
Dnajc16 G A 4: 141,763,653 R729* probably null Het
Dscr3 A G 16: 94,510,806 F95L probably benign Het
Eml6 C T 11: 29,749,905 A1744T possibly damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fbll1 T A 11: 35,797,699 T246S probably benign Het
Fbln2 A T 6: 91,266,371 T910S probably damaging Het
Fcna C T 2: 25,627,772 G22D possibly damaging Het
Gadl1 G T 9: 116,006,664 E387* probably null Het
Gm5592 G A 7: 41,157,835 probably benign Het
Gpr82 A T X: 13,665,338 T42S probably benign Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Lbr G A 1: 181,831,715 T167I probably benign Het
Muc2 A G 7: 141,754,344 H420R probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nrcam G T 12: 44,575,884 A938S probably benign Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Olfr406 A T 11: 74,270,279 K297* probably null Het
Olfr419 T A 1: 174,250,150 Y259F probably damaging Het
Olfr550 T G 7: 102,579,020 L175R probably damaging Het
Pgap3 T C 11: 98,390,812 T187A possibly damaging Het
Pus10 T C 11: 23,703,003 probably null Het
Rnf213 T C 11: 119,480,939 probably benign Het
Sag T C 1: 87,824,518 probably benign Het
Serpinb9e A G 13: 33,255,154 I188V probably benign Het
Shcbp1l A T 1: 153,452,444 I634F probably damaging Het
Slc6a16 T A 7: 45,268,172 C485S probably damaging Het
Vmn1r215 A C 13: 23,075,888 M33L probably benign Het
Other mutations in Mdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02171:Mdh1 APN 11 21557438 utr 3 prime probably benign
IGL02273:Mdh1 APN 11 21559786 missense probably benign 0.38
IGL03198:Mdh1 APN 11 21564168 missense probably damaging 1.00
PIT4480001:Mdh1 UTSW 11 21558538 missense probably damaging 1.00
R0771:Mdh1 UTSW 11 21557550 missense probably benign 0.27
R1016:Mdh1 UTSW 11 21559769 missense probably benign 0.01
R3855:Mdh1 UTSW 11 21559281 missense probably benign 0.31
R3886:Mdh1 UTSW 11 21559832 missense probably damaging 0.97
R4474:Mdh1 UTSW 11 21566624 missense possibly damaging 0.49
R4507:Mdh1 UTSW 11 21558470 missense probably benign 0.01
R4724:Mdh1 UTSW 11 21562957 missense probably damaging 1.00
R4986:Mdh1 UTSW 11 21558545 missense possibly damaging 0.85
R5472:Mdh1 UTSW 11 21559786 missense probably benign 0.38
R7088:Mdh1 UTSW 11 21558484 missense probably damaging 1.00
X0063:Mdh1 UTSW 11 21562870 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GACAGTTGACAGCACAGCTTAG -3'
(R):5'- GCTTCCCTGTATTTAGTGTCACATG -3'

Sequencing Primer
(F):5'- AAGTAACATTTGGGGGCTCC -3'
(R):5'- TTTCAGCCATGCTTGCAG -3'
Posted On2015-04-06