Incidental Mutation 'R3855:Zfp512'
ID276101
Institutional Source Beutler Lab
Gene Symbol Zfp512
Ensembl Gene ENSMUSG00000062761
Gene Namezinc finger protein 512
Synonyms
MMRRC Submission 040901-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.356) question?
Stock #R3855 (G1)
Quality Score174
Status Validated
Chromosome5
Chromosomal Location31452431-31481754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31480249 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 505 (R505G)
Ref Sequence ENSEMBL: ENSMUSP00000143860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076264] [ENSMUST00000202244]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076264
AA Change: R561G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075613
Gene: ENSMUSG00000062761
AA Change: R561G

DomainStartEndE-ValueType
low complexity region 51 65 N/A INTRINSIC
low complexity region 92 106 N/A INTRINSIC
Blast:ZnF_C2H2 172 197 2e-8 BLAST
ZnF_C2H2 200 223 3.78e-1 SMART
ZnF_C2H2 254 276 2.63e2 SMART
ZnF_C2H2 290 313 3.39e-3 SMART
ZnF_C2H2 408 430 7.37e1 SMART
ZnF_C2H2 442 465 3.11e-2 SMART
low complexity region 485 511 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202244
AA Change: R505G

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143860
Gene: ENSMUSG00000062761
AA Change: R505G

DomainStartEndE-ValueType
low complexity region 51 65 N/A INTRINSIC
low complexity region 92 106 N/A INTRINSIC
Blast:ZnF_C2H2 172 197 1e-8 BLAST
ZnF_C2H2 200 223 1.6e-3 SMART
ZnF_C2H2 352 374 3.2e-1 SMART
ZnF_C2H2 386 409 1.4e-4 SMART
low complexity region 429 455 N/A INTRINSIC
Meta Mutation Damage Score 0.0746 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing four putative zinc finger motifs. Zinc finger motifs may bind to proteins or nucleic acids. Zinc finger-containing proteins are involved in a variety of processes, including regulation of transcription. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna A T 4: 63,373,468 S1144R probably damaging Het
Apbb1ip T C 2: 22,875,175 S623P unknown Het
Apex1 A G 14: 50,926,257 T109A probably benign Het
Arhgef1 G A 7: 24,919,272 G107S probably damaging Het
Cdc42bpa A G 1: 180,155,978 probably benign Het
Cog2 T C 8: 124,530,003 probably null Het
Dennd4c G A 4: 86,779,847 V191M probably damaging Het
Dscr3 A G 16: 94,510,806 F95L probably benign Het
Dthd1 T A 5: 62,827,129 H392Q probably benign Het
Dthd1 T C 5: 62,888,023 V710A probably benign Het
Fam58b T C 11: 78,751,187 N159S probably benign Het
Galnt7 T C 8: 57,532,624 probably benign Het
Gm4868 A G 5: 125,848,545 noncoding transcript Het
Gpr179 T C 11: 97,341,434 E648G probably damaging Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Itgb3bp T C 4: 99,798,720 E76G possibly damaging Het
Khk A G 5: 30,927,057 D82G probably benign Het
Kif17 A G 4: 138,291,510 S533G probably benign Het
Kmt2a A G 9: 44,830,499 probably benign Het
Kmt5c T C 7: 4,746,256 F104S probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Mdh1 C T 11: 21,559,281 V234I probably benign Het
Nbas T A 12: 13,279,414 I120N possibly damaging Het
Nfia A G 4: 98,063,022 H362R probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nme5 A G 18: 34,569,831 S135P possibly damaging Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Nufip2 T C 11: 77,692,889 V543A probably damaging Het
Olfr1380 A G 11: 49,564,091 T57A probably damaging Het
Olfr364-ps1 A T 2: 37,146,823 I204F possibly damaging Het
Otog T C 7: 46,273,760 S1020P possibly damaging Het
Pear1 T C 3: 87,751,921 H814R possibly damaging Het
Pkd1l1 A G 11: 8,965,047 probably null Het
Pla2g4a T A 1: 149,830,177 I711F possibly damaging Het
Ppig G A 2: 69,749,375 V418I unknown Het
Prg4 T C 1: 150,452,000 Y234C probably damaging Het
Prmt9 G A 8: 77,568,265 V413I probably benign Het
Rnf145 G A 11: 44,531,293 V68M possibly damaging Het
Sepsecs G A 5: 52,664,274 R74C probably damaging Het
Sgsm1 A G 5: 113,263,259 V580A probably benign Het
Sh3bp1 C T 15: 78,901,161 probably benign Het
Sox11 C A 12: 27,341,502 G303C probably damaging Het
Usp54 C A 14: 20,588,420 M197I probably damaging Het
Xylt1 T G 7: 117,593,550 L361R probably damaging Het
Other mutations in Zfp512
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Zfp512 APN 5 31473496 missense probably damaging 1.00
IGL02657:Zfp512 APN 5 31471157 missense probably damaging 1.00
PIT4504001:Zfp512 UTSW 5 31476881 critical splice donor site probably null
R2054:Zfp512 UTSW 5 31465449 missense probably benign 0.03
R2228:Zfp512 UTSW 5 31465575 missense probably damaging 1.00
R2679:Zfp512 UTSW 5 31465454 missense probably benign 0.00
R2982:Zfp512 UTSW 5 31476778 splice site probably null
R3857:Zfp512 UTSW 5 31472840 missense probably damaging 1.00
R3858:Zfp512 UTSW 5 31472840 missense probably damaging 1.00
R4603:Zfp512 UTSW 5 31480226 missense probably benign 0.07
R4827:Zfp512 UTSW 5 31472814 missense probably benign 0.16
R4915:Zfp512 UTSW 5 31476865 missense probably damaging 1.00
R4918:Zfp512 UTSW 5 31476865 missense probably damaging 1.00
R5906:Zfp512 UTSW 5 31480064 missense probably damaging 1.00
R6520:Zfp512 UTSW 5 31466640 missense probably damaging 1.00
R7508:Zfp512 UTSW 5 31473539 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCCCCTGCAGGATTGGTTTG -3'
(R):5'- CCAAGGGAATATGAACCTACTGAG -3'

Sequencing Primer
(F):5'- GGTTTGTTGTGAACCCAACAACC -3'
(R):5'- CCTACTGAGGCAGGGAGG -3'
Posted On2015-04-06