Incidental Mutation 'R3855:Sepsecs'
ID276102
Institutional Source Beutler Lab
Gene Symbol Sepsecs
Ensembl Gene ENSMUSG00000029173
Gene NameSep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase
SynonymsD5Ertd135e, SLA, SecS
MMRRC Submission 040901-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R3855 (G1)
Quality Score207
Status Validated
Chromosome5
Chromosomal Location52640087-52669708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 52664274 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 74 (R74C)
Ref Sequence ENSEMBL: ENSMUSP00000114413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031069] [ENSMUST00000126574] [ENSMUST00000150709]
Predicted Effect probably damaging
Transcript: ENSMUST00000031069
AA Change: R199C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031069
Gene: ENSMUSG00000029173
AA Change: R199C

DomainStartEndE-ValueType
Pfam:SepSecS 61 459 4e-182 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123856
SMART Domains Protein: ENSMUSP00000114760
Gene: ENSMUSG00000029173

DomainStartEndE-ValueType
PDB:3BCB|A 2 45 4e-24 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000126574
AA Change: R74C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114413
Gene: ENSMUSG00000029173
AA Change: R74C

DomainStartEndE-ValueType
Pfam:SLA_LP_auto_ag 1 116 5.8e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150709
SMART Domains Protein: ENSMUSP00000115477
Gene: ENSMUSG00000029173

DomainStartEndE-ValueType
PDB:3HL2|D 1 69 4e-39 PDB
Meta Mutation Damage Score 0.1402 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The amino acid selenocysteine is the only amino acid that does not have its own tRNA synthetase. Instead, this amino acid is synthesized on its cognate tRNA in a three step process. The protein encoded by this gene catalyzes the third step in the process, the conversion of O-phosphoseryl-tRNA(Sec) to selenocysteinyl-tRNA(Sec).[provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna A T 4: 63,373,468 S1144R probably damaging Het
Apbb1ip T C 2: 22,875,175 S623P unknown Het
Apex1 A G 14: 50,926,257 T109A probably benign Het
Arhgef1 G A 7: 24,919,272 G107S probably damaging Het
Cdc42bpa A G 1: 180,155,978 probably benign Het
Cog2 T C 8: 124,530,003 probably null Het
Dennd4c G A 4: 86,779,847 V191M probably damaging Het
Dscr3 A G 16: 94,510,806 F95L probably benign Het
Dthd1 T A 5: 62,827,129 H392Q probably benign Het
Dthd1 T C 5: 62,888,023 V710A probably benign Het
Fam58b T C 11: 78,751,187 N159S probably benign Het
Galnt7 T C 8: 57,532,624 probably benign Het
Gm4868 A G 5: 125,848,545 noncoding transcript Het
Gpr179 T C 11: 97,341,434 E648G probably damaging Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Itgb3bp T C 4: 99,798,720 E76G possibly damaging Het
Khk A G 5: 30,927,057 D82G probably benign Het
Kif17 A G 4: 138,291,510 S533G probably benign Het
Kmt2a A G 9: 44,830,499 probably benign Het
Kmt5c T C 7: 4,746,256 F104S probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Mdh1 C T 11: 21,559,281 V234I probably benign Het
Nbas T A 12: 13,279,414 I120N possibly damaging Het
Nfia A G 4: 98,063,022 H362R probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nme5 A G 18: 34,569,831 S135P possibly damaging Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Nufip2 T C 11: 77,692,889 V543A probably damaging Het
Olfr1380 A G 11: 49,564,091 T57A probably damaging Het
Olfr364-ps1 A T 2: 37,146,823 I204F possibly damaging Het
Otog T C 7: 46,273,760 S1020P possibly damaging Het
Pear1 T C 3: 87,751,921 H814R possibly damaging Het
Pkd1l1 A G 11: 8,965,047 probably null Het
Pla2g4a T A 1: 149,830,177 I711F possibly damaging Het
Ppig G A 2: 69,749,375 V418I unknown Het
Prg4 T C 1: 150,452,000 Y234C probably damaging Het
Prmt9 G A 8: 77,568,265 V413I probably benign Het
Rnf145 G A 11: 44,531,293 V68M possibly damaging Het
Sgsm1 A G 5: 113,263,259 V580A probably benign Het
Sh3bp1 C T 15: 78,901,161 probably benign Het
Sox11 C A 12: 27,341,502 G303C probably damaging Het
Usp54 C A 14: 20,588,420 M197I probably damaging Het
Xylt1 T G 7: 117,593,550 L361R probably damaging Het
Zfp512 A G 5: 31,480,249 R505G possibly damaging Het
Other mutations in Sepsecs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Sepsecs APN 5 52644060 missense probably benign 0.00
IGL02685:Sepsecs APN 5 52647192 missense probably benign
IGL03033:Sepsecs APN 5 52660676 missense probably damaging 1.00
R1051:Sepsecs UTSW 5 52665356 missense probably damaging 1.00
R1240:Sepsecs UTSW 5 52660679 missense probably damaging 1.00
R2014:Sepsecs UTSW 5 52647624 missense probably benign
R2015:Sepsecs UTSW 5 52647624 missense probably benign
R4687:Sepsecs UTSW 5 52643871 missense probably benign 0.00
R5120:Sepsecs UTSW 5 52660661 missense probably damaging 1.00
R5314:Sepsecs UTSW 5 52647673 missense probably benign 0.01
R5468:Sepsecs UTSW 5 52644014 missense probably damaging 1.00
R6924:Sepsecs UTSW 5 52664304 missense probably benign 0.13
R7002:Sepsecs UTSW 5 52647208 critical splice acceptor site probably null
R7507:Sepsecs UTSW 5 52644055 missense probably damaging 0.99
R7527:Sepsecs UTSW 5 52644051 missense possibly damaging 0.85
R7792:Sepsecs UTSW 5 52644049 missense probably damaging 1.00
R7798:Sepsecs UTSW 5 52647189 missense probably benign
RF003:Sepsecs UTSW 5 52647191 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CACTACTTGAGACTCAGTGGACAG -3'
(R):5'- GACTAATGCCAGCTCTTAGCC -3'

Sequencing Primer
(F):5'- AGACTCAGTGGACAGCCTGTC -3'
(R):5'- AGCCACCATCTTTATTACTAGAGG -3'
Posted On2015-04-06