Mutagenetix > Incidental Mutation

Incidental Mutation 'R3855:Sgsm1'

276105

Institutional Source

Beutler Lab

Gene Symbol

Sgsm1

Ensembl Gene

ENSMUSG00000042216

Gene Name

small G protein signaling modulator 1

Synonyms

Rutbc2, 2410098H20Rik, D5Bwg1524e

MMRRC Submission

040901-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3855 (G1)

Quality Score

157

Status

Validated

Chromosome

Chromosomal Location

113243220-113310786 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 113263259 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 580 (V580A)

Ref Sequence

ENSEMBL: ENSMUSP00000084106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048112] [ENSMUST00000057209] [ENSMUST00000112325] [ENSMUST00000154248]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000048112
AA Change: V867A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000046544
Gene: ENSMUSG00000042216
AA Change: V867A

Domain	Start	End	E-Value	Type
RUN	127	187	6.52e-18	SMART
low complexity region	401	413	N/A	INTRINSIC
low complexity region	454	469	N/A	INTRINSIC
TBC	559	1053	2.88e-29	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000057209
AA Change: V580A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000084106
Gene: ENSMUSG00000042216
AA Change: V580A

Domain	Start	End	E-Value	Type
low complexity region	114	126	N/A	INTRINSIC
low complexity region	167	182	N/A	INTRINSIC
TBC	272	766	2.88e-29	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112325

SMART Domains

Protein: ENSMUSP00000107944
Gene: ENSMUSG00000042216

Domain	Start	End	E-Value	Type
RUN	127	187	6.52e-18	SMART
low complexity region	401	413	N/A	INTRINSIC
low complexity region	454	469	N/A	INTRINSIC
SCOP:d1fkma1	539	615	1e-6	SMART
Blast:TBC	559	675	1e-71	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145708

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147856

Predicted Effect

probably benign
Transcript: ENSMUST00000154248

SMART Domains

Protein: ENSMUSP00000114932
Gene: ENSMUSG00000042216

Domain	Start	End	E-Value	Type
RUN	127	187	6.52e-18	SMART
low complexity region	401	413	N/A	INTRINSIC
low complexity region	509	524	N/A	INTRINSIC
SCOP:d1fkma1	594	670	9e-7	SMART
Blast:TBC	614	706	3e-55	BLAST

Meta Mutation Damage Score

0.0925

Coding Region Coverage

1x: 99.6%
3x: 98.7%
10x: 96.9%
20x: 93.3%

Validation Efficiency

98% (45/46)

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akna	A	T	4: 63,373,468	S1144R	probably damaging	Het
Apbb1ip	T	C	2: 22,875,175	S623P	unknown	Het
Apex1	A	G	14: 50,926,257	T109A	probably benign	Het
Arhgef1	G	A	7: 24,919,272	G107S	probably damaging	Het
Cdc42bpa	A	G	1: 180,155,978		probably benign	Het
Cog2	T	C	8: 124,530,003		probably null	Het
Dennd4c	G	A	4: 86,779,847	V191M	probably damaging	Het
Dscr3	A	G	16: 94,510,806	F95L	probably benign	Het
Dthd1	T	A	5: 62,827,129	H392Q	probably benign	Het
Dthd1	T	C	5: 62,888,023	V710A	probably benign	Het
Fam58b	T	C	11: 78,751,187	N159S	probably benign	Het
Galnt7	T	C	8: 57,532,624		probably benign	Het
Gm4868	A	G	5: 125,848,545		noncoding transcript	Het
Gpr179	T	C	11: 97,341,434	E648G	probably damaging	Het
Hk2	T	C	6: 82,736,676	E447G	possibly damaging	Het
Idi1	G	T	13: 8,885,932	A25S	probably benign	Het
Itgb3bp	T	C	4: 99,798,720	E76G	possibly damaging	Het
Khk	A	G	5: 30,927,057	D82G	probably benign	Het
Kif17	A	G	4: 138,291,510	S533G	probably benign	Het
Kmt2a	A	G	9: 44,830,499		probably benign	Het
Kmt5c	T	C	7: 4,746,256	F104S	probably damaging	Het
Lmf1	G	A	17: 25,654,471	V317M	probably damaging	Het
Mdh1	C	T	11: 21,559,281	V234I	probably benign	Het
Nbas	T	A	12: 13,279,414	I120N	possibly damaging	Het
Nfia	A	G	4: 98,063,022	H362R	probably damaging	Het
Nhlrc2	T	C	19: 56,588,271		probably null	Het
Nme5	A	G	18: 34,569,831	S135P	possibly damaging	Het
Nt5c2	A	G	19: 46,896,518	V252A	probably damaging	Het
Nufip2	T	C	11: 77,692,889	V543A	probably damaging	Het
Olfr1380	A	G	11: 49,564,091	T57A	probably damaging	Het
Olfr364-ps1	A	T	2: 37,146,823	I204F	possibly damaging	Het
Otog	T	C	7: 46,273,760	S1020P	possibly damaging	Het
Pear1	T	C	3: 87,751,921	H814R	possibly damaging	Het
Pkd1l1	A	G	11: 8,965,047		probably null	Het
Pla2g4a	T	A	1: 149,830,177	I711F	possibly damaging	Het
Ppig	G	A	2: 69,749,375	V418I	unknown	Het
Prg4	T	C	1: 150,452,000	Y234C	probably damaging	Het
Prmt9	G	A	8: 77,568,265	V413I	probably benign	Het
Rnf145	G	A	11: 44,531,293	V68M	possibly damaging	Het
Sepsecs	G	A	5: 52,664,274	R74C	probably damaging	Het
Sh3bp1	C	T	15: 78,901,161		probably benign	Het
Sox11	C	A	12: 27,341,502	G303C	probably damaging	Het
Usp54	C	A	14: 20,588,420	M197I	probably damaging	Het
Xylt1	T	G	7: 117,593,550	L361R	probably damaging	Het
Zfp512	A	G	5: 31,480,249	R505G	possibly damaging	Het

Other mutations in Sgsm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Sgsm1	APN	5	113245064	missense	probably benign	0.00
IGL00503:Sgsm1	APN	5	113276142	missense	probably benign	0.00
IGL01377:Sgsm1	APN	5	113276182	splice site	probably benign
IGL01602:Sgsm1	APN	5	113285665	missense	possibly damaging	0.92
IGL01605:Sgsm1	APN	5	113285665	missense	possibly damaging	0.92
IGL01669:Sgsm1	APN	5	113263490	missense	probably benign
IGL01920:Sgsm1	APN	5	113273605	missense	probably damaging	1.00
IGL01951:Sgsm1	APN	5	113286767	splice site	probably benign
IGL02387:Sgsm1	APN	5	113253063	missense	possibly damaging	0.93
IGL02690:Sgsm1	APN	5	113286767	splice site	probably benign
IGL03177:Sgsm1	APN	5	113250993	missense	probably damaging	1.00
IGL03186:Sgsm1	APN	5	113285021	missense	probably benign	0.00
IGL03398:Sgsm1	APN	5	113255316	missense	possibly damaging	0.67
caliente	UTSW	5	113280462	intron	probably benign
Chili	UTSW	5	113258123	intron	probably benign
pimiento	UTSW	5	113263257	missense	probably benign	0.15
R0048:Sgsm1	UTSW	5	113268750	missense	probably damaging	1.00
R0058:Sgsm1	UTSW	5	113285087	missense	probably damaging	1.00
R0058:Sgsm1	UTSW	5	113285087	missense	probably damaging	1.00
R0082:Sgsm1	UTSW	5	113288836	missense	probably benign	0.01
R0085:Sgsm1	UTSW	5	113279270	splice site	probably benign
R0099:Sgsm1	UTSW	5	113274360	splice site	probably benign
R0269:Sgsm1	UTSW	5	113286929	critical splice acceptor site	probably null
R0310:Sgsm1	UTSW	5	113263705	missense	probably benign	0.00
R0325:Sgsm1	UTSW	5	113288835	missense	probably damaging	0.99
R0420:Sgsm1	UTSW	5	113263759	missense	probably benign	0.16
R0594:Sgsm1	UTSW	5	113310562	missense	probably benign	0.00
R0599:Sgsm1	UTSW	5	113245028	missense	probably damaging	1.00
R0631:Sgsm1	UTSW	5	113285123	splice site	probably benign
R0744:Sgsm1	UTSW	5	113279184	missense	probably benign	0.38
R0833:Sgsm1	UTSW	5	113279184	missense	probably benign	0.38
R0919:Sgsm1	UTSW	5	113258842	missense	probably damaging	1.00
R0944:Sgsm1	UTSW	5	113265874	missense	probably benign	0.40
R1169:Sgsm1	UTSW	5	113279485	missense	probably damaging	1.00
R1232:Sgsm1	UTSW	5	113273711	nonsense	probably null
R1473:Sgsm1	UTSW	5	113263257	missense	probably benign	0.15
R1535:Sgsm1	UTSW	5	113263269	missense	possibly damaging	0.93
R1796:Sgsm1	UTSW	5	113273617	missense	possibly damaging	0.58
R1878:Sgsm1	UTSW	5	113263515	missense	probably damaging	0.97
R2084:Sgsm1	UTSW	5	113285400	missense	probably damaging	1.00
R3856:Sgsm1	UTSW	5	113263259	missense	probably benign	0.01
R4294:Sgsm1	UTSW	5	113285404	missense	probably damaging	1.00
R4373:Sgsm1	UTSW	5	113258123	intron	probably benign
R4558:Sgsm1	UTSW	5	113258111	intron	probably benign
R4610:Sgsm1	UTSW	5	113255307	missense	probably damaging	1.00
R4667:Sgsm1	UTSW	5	113260047	critical splice donor site	probably null
R4838:Sgsm1	UTSW	5	113282626	missense	probably damaging	1.00
R4890:Sgsm1	UTSW	5	113280462	intron	probably benign
R4992:Sgsm1	UTSW	5	113282620	missense	possibly damaging	0.89
R5366:Sgsm1	UTSW	5	113251039	missense	possibly damaging	0.91
R5776:Sgsm1	UTSW	5	113250957	missense	probably damaging	1.00
R5813:Sgsm1	UTSW	5	113250956	missense	probably damaging	1.00
R6000:Sgsm1	UTSW	5	113286838	missense	probably damaging	1.00
R6354:Sgsm1	UTSW	5	113282656	missense	probably damaging	0.99
R6440:Sgsm1	UTSW	5	113279131	critical splice donor site	probably null
R6831:Sgsm1	UTSW	5	113280380	missense	probably damaging	0.97
R7307:Sgsm1	UTSW	5	113273646	missense	probably benign	0.00
R7309:Sgsm1	UTSW	5	113268846	splice site	probably null
R7387:Sgsm1	UTSW	5	113263700	missense	probably damaging	1.00
R7439:Sgsm1	UTSW	5	113274321	missense	probably damaging	0.99
R7485:Sgsm1	UTSW	5	113279635	splice site	probably null
R7624:Sgsm1	UTSW	5	113274335	nonsense	probably null
R7632:Sgsm1	UTSW	5	113276082	missense	possibly damaging	0.54
R7669:Sgsm1	UTSW	5	113253024	missense	probably damaging	1.00
R7727:Sgsm1	UTSW	5	113274327	missense	possibly damaging	0.95
R7732:Sgsm1	UTSW	5	113266330	missense	probably benign	0.26
R7961:Sgsm1	UTSW	5	113282644	missense	probably damaging	1.00
R8088:Sgsm1	UTSW	5	113255268	missense	probably damaging	1.00
R8213:Sgsm1	UTSW	5	113251011	missense	probably damaging	1.00
R8278:Sgsm1	UTSW	5	113260092	missense	probably damaging	0.98
R8480:Sgsm1	UTSW	5	113263418	missense	probably benign	0.01
R8796:Sgsm1	UTSW	5	113263257	missense	probably benign	0.15
R8816:Sgsm1	UTSW	5	113287231	missense	probably damaging	1.00
R8904:Sgsm1	UTSW	5	113273629	missense	probably benign	0.00
R8905:Sgsm1	UTSW	5	113273629	missense	probably benign	0.00
R8952:Sgsm1	UTSW	5	113284995	missense	probably damaging	1.00
R9046:Sgsm1	UTSW	5	113288859	missense	probably damaging	1.00
R9162:Sgsm1	UTSW	5	113282711	missense	probably damaging	1.00
R9249:Sgsm1	UTSW	5	113280335	missense	possibly damaging	0.86
R9375:Sgsm1	UTSW	5	113274273	missense	unknown
R9377:Sgsm1	UTSW	5	113288875	missense	probably damaging	1.00
R9461:Sgsm1	UTSW	5	113276032	critical splice donor site	probably null
R9662:Sgsm1	UTSW	5	113279231	missense	probably benign	0.03
R9722:Sgsm1	UTSW	5	113280341	missense	possibly damaging	0.75
R9726:Sgsm1	UTSW	5	113310552	missense	probably benign
Z1177:Sgsm1	UTSW	5	113282710	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGCTAAAGTCTGTGAAGGCAG -3'
(R):5'- AGGAGTTCATGTCTATCCCTGG -3'

Sequencing Primer
(F):5'- GAGGGCAACATGGTGGCTC -3'
(R):5'- TGGCCCTACCTGAGAAGGATG -3'

Posted On

2015-04-06