Incidental Mutation 'R3855:Sgsm1'
ID 276105
Institutional Source Beutler Lab
Gene Symbol Sgsm1
Ensembl Gene ENSMUSG00000042216
Gene Name small G protein signaling modulator 1
Synonyms Rutbc2, 2410098H20Rik, D5Bwg1524e
MMRRC Submission 040901-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3855 (G1)
Quality Score 157
Status Validated
Chromosome 5
Chromosomal Location 113243220-113310786 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113263259 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 580 (V580A)
Ref Sequence ENSEMBL: ENSMUSP00000084106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048112] [ENSMUST00000057209] [ENSMUST00000112325] [ENSMUST00000154248]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000048112
AA Change: V867A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000046544
Gene: ENSMUSG00000042216
AA Change: V867A

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
TBC 559 1053 2.88e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057209
AA Change: V580A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000084106
Gene: ENSMUSG00000042216
AA Change: V580A

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
TBC 272 766 2.88e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112325
SMART Domains Protein: ENSMUSP00000107944
Gene: ENSMUSG00000042216

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
SCOP:d1fkma1 539 615 1e-6 SMART
Blast:TBC 559 675 1e-71 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147856
Predicted Effect probably benign
Transcript: ENSMUST00000154248
SMART Domains Protein: ENSMUSP00000114932
Gene: ENSMUSG00000042216

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
SCOP:d1fkma1 594 670 9e-7 SMART
Blast:TBC 614 706 3e-55 BLAST
Meta Mutation Damage Score 0.0925 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna A T 4: 63,373,468 S1144R probably damaging Het
Apbb1ip T C 2: 22,875,175 S623P unknown Het
Apex1 A G 14: 50,926,257 T109A probably benign Het
Arhgef1 G A 7: 24,919,272 G107S probably damaging Het
Cdc42bpa A G 1: 180,155,978 probably benign Het
Cog2 T C 8: 124,530,003 probably null Het
Dennd4c G A 4: 86,779,847 V191M probably damaging Het
Dscr3 A G 16: 94,510,806 F95L probably benign Het
Dthd1 T A 5: 62,827,129 H392Q probably benign Het
Dthd1 T C 5: 62,888,023 V710A probably benign Het
Fam58b T C 11: 78,751,187 N159S probably benign Het
Galnt7 T C 8: 57,532,624 probably benign Het
Gm4868 A G 5: 125,848,545 noncoding transcript Het
Gpr179 T C 11: 97,341,434 E648G probably damaging Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Itgb3bp T C 4: 99,798,720 E76G possibly damaging Het
Khk A G 5: 30,927,057 D82G probably benign Het
Kif17 A G 4: 138,291,510 S533G probably benign Het
Kmt2a A G 9: 44,830,499 probably benign Het
Kmt5c T C 7: 4,746,256 F104S probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Mdh1 C T 11: 21,559,281 V234I probably benign Het
Nbas T A 12: 13,279,414 I120N possibly damaging Het
Nfia A G 4: 98,063,022 H362R probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nme5 A G 18: 34,569,831 S135P possibly damaging Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Nufip2 T C 11: 77,692,889 V543A probably damaging Het
Olfr1380 A G 11: 49,564,091 T57A probably damaging Het
Olfr364-ps1 A T 2: 37,146,823 I204F possibly damaging Het
Otog T C 7: 46,273,760 S1020P possibly damaging Het
Pear1 T C 3: 87,751,921 H814R possibly damaging Het
Pkd1l1 A G 11: 8,965,047 probably null Het
Pla2g4a T A 1: 149,830,177 I711F possibly damaging Het
Ppig G A 2: 69,749,375 V418I unknown Het
Prg4 T C 1: 150,452,000 Y234C probably damaging Het
Prmt9 G A 8: 77,568,265 V413I probably benign Het
Rnf145 G A 11: 44,531,293 V68M possibly damaging Het
Sepsecs G A 5: 52,664,274 R74C probably damaging Het
Sh3bp1 C T 15: 78,901,161 probably benign Het
Sox11 C A 12: 27,341,502 G303C probably damaging Het
Usp54 C A 14: 20,588,420 M197I probably damaging Het
Xylt1 T G 7: 117,593,550 L361R probably damaging Het
Zfp512 A G 5: 31,480,249 R505G possibly damaging Het
Other mutations in Sgsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Sgsm1 APN 5 113245064 missense probably benign 0.00
IGL00503:Sgsm1 APN 5 113276142 missense probably benign 0.00
IGL01377:Sgsm1 APN 5 113276182 splice site probably benign
IGL01602:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01605:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01669:Sgsm1 APN 5 113263490 missense probably benign
IGL01920:Sgsm1 APN 5 113273605 missense probably damaging 1.00
IGL01951:Sgsm1 APN 5 113286767 splice site probably benign
IGL02387:Sgsm1 APN 5 113253063 missense possibly damaging 0.93
IGL02690:Sgsm1 APN 5 113286767 splice site probably benign
IGL03177:Sgsm1 APN 5 113250993 missense probably damaging 1.00
IGL03186:Sgsm1 APN 5 113285021 missense probably benign 0.00
IGL03398:Sgsm1 APN 5 113255316 missense possibly damaging 0.67
caliente UTSW 5 113280462 intron probably benign
Chili UTSW 5 113258123 intron probably benign
pimiento UTSW 5 113263257 missense probably benign 0.15
R0048:Sgsm1 UTSW 5 113268750 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0082:Sgsm1 UTSW 5 113288836 missense probably benign 0.01
R0085:Sgsm1 UTSW 5 113279270 splice site probably benign
R0099:Sgsm1 UTSW 5 113274360 splice site probably benign
R0269:Sgsm1 UTSW 5 113286929 critical splice acceptor site probably null
R0310:Sgsm1 UTSW 5 113263705 missense probably benign 0.00
R0325:Sgsm1 UTSW 5 113288835 missense probably damaging 0.99
R0420:Sgsm1 UTSW 5 113263759 missense probably benign 0.16
R0594:Sgsm1 UTSW 5 113310562 missense probably benign 0.00
R0599:Sgsm1 UTSW 5 113245028 missense probably damaging 1.00
R0631:Sgsm1 UTSW 5 113285123 splice site probably benign
R0744:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0833:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0919:Sgsm1 UTSW 5 113258842 missense probably damaging 1.00
R0944:Sgsm1 UTSW 5 113265874 missense probably benign 0.40
R1169:Sgsm1 UTSW 5 113279485 missense probably damaging 1.00
R1232:Sgsm1 UTSW 5 113273711 nonsense probably null
R1473:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R1535:Sgsm1 UTSW 5 113263269 missense possibly damaging 0.93
R1796:Sgsm1 UTSW 5 113273617 missense possibly damaging 0.58
R1878:Sgsm1 UTSW 5 113263515 missense probably damaging 0.97
R2084:Sgsm1 UTSW 5 113285400 missense probably damaging 1.00
R3856:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R4294:Sgsm1 UTSW 5 113285404 missense probably damaging 1.00
R4373:Sgsm1 UTSW 5 113258123 intron probably benign
R4558:Sgsm1 UTSW 5 113258111 intron probably benign
R4610:Sgsm1 UTSW 5 113255307 missense probably damaging 1.00
R4667:Sgsm1 UTSW 5 113260047 critical splice donor site probably null
R4838:Sgsm1 UTSW 5 113282626 missense probably damaging 1.00
R4890:Sgsm1 UTSW 5 113280462 intron probably benign
R4992:Sgsm1 UTSW 5 113282620 missense possibly damaging 0.89
R5366:Sgsm1 UTSW 5 113251039 missense possibly damaging 0.91
R5776:Sgsm1 UTSW 5 113250957 missense probably damaging 1.00
R5813:Sgsm1 UTSW 5 113250956 missense probably damaging 1.00
R6000:Sgsm1 UTSW 5 113286838 missense probably damaging 1.00
R6354:Sgsm1 UTSW 5 113282656 missense probably damaging 0.99
R6440:Sgsm1 UTSW 5 113279131 critical splice donor site probably null
R6831:Sgsm1 UTSW 5 113280380 missense probably damaging 0.97
R7307:Sgsm1 UTSW 5 113273646 missense probably benign 0.00
R7309:Sgsm1 UTSW 5 113268846 splice site probably null
R7387:Sgsm1 UTSW 5 113263700 missense probably damaging 1.00
R7439:Sgsm1 UTSW 5 113274321 missense probably damaging 0.99
R7485:Sgsm1 UTSW 5 113279635 splice site probably null
R7624:Sgsm1 UTSW 5 113274335 nonsense probably null
R7632:Sgsm1 UTSW 5 113276082 missense possibly damaging 0.54
R7669:Sgsm1 UTSW 5 113253024 missense probably damaging 1.00
R7727:Sgsm1 UTSW 5 113274327 missense possibly damaging 0.95
R7732:Sgsm1 UTSW 5 113266330 missense probably benign 0.26
R7961:Sgsm1 UTSW 5 113282644 missense probably damaging 1.00
R8088:Sgsm1 UTSW 5 113255268 missense probably damaging 1.00
R8213:Sgsm1 UTSW 5 113251011 missense probably damaging 1.00
R8278:Sgsm1 UTSW 5 113260092 missense probably damaging 0.98
R8480:Sgsm1 UTSW 5 113263418 missense probably benign 0.01
R8796:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R8816:Sgsm1 UTSW 5 113287231 missense probably damaging 1.00
R8904:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8905:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8952:Sgsm1 UTSW 5 113284995 missense probably damaging 1.00
R9046:Sgsm1 UTSW 5 113288859 missense probably damaging 1.00
R9162:Sgsm1 UTSW 5 113282711 missense probably damaging 1.00
R9249:Sgsm1 UTSW 5 113280335 missense possibly damaging 0.86
R9375:Sgsm1 UTSW 5 113274273 missense unknown
R9377:Sgsm1 UTSW 5 113288875 missense probably damaging 1.00
R9461:Sgsm1 UTSW 5 113276032 critical splice donor site probably null
R9662:Sgsm1 UTSW 5 113279231 missense probably benign 0.03
R9722:Sgsm1 UTSW 5 113280341 missense possibly damaging 0.75
R9726:Sgsm1 UTSW 5 113310552 missense probably benign
Z1177:Sgsm1 UTSW 5 113282710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTAAAGTCTGTGAAGGCAG -3'
(R):5'- AGGAGTTCATGTCTATCCCTGG -3'

Sequencing Primer
(F):5'- GAGGGCAACATGGTGGCTC -3'
(R):5'- TGGCCCTACCTGAGAAGGATG -3'
Posted On 2015-04-06