Mutagenetix > Incidental Mutation

Incidental Mutation 'R3855:Cog2'

276117

Institutional Source

Beutler Lab

Gene Symbol

Cog2

Ensembl Gene

ENSMUSG00000031979

Gene Name

component of oligomeric golgi complex 2

Synonyms

2700012E02Rik, 1190002B08Rik, Cog2

MMRRC Submission

040901-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3855 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124520767-124552008 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 124530003 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000034460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034460] [ENSMUST00000176159] [ENSMUST00000176279]

AlphaFold

Q921L5

Predicted Effect

probably null
Transcript: ENSMUST00000034460

SMART Domains

Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979

Domain	Start	End	E-Value	Type
Pfam:COG2	15	147	1.4e-44	PFAM
low complexity region	207	220	N/A	INTRINSIC
low complexity region	490	502	N/A	INTRINSIC
Pfam:DUF3510	565	692	6.1e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000108803

Predicted Effect

probably benign
Transcript: ENSMUST00000176159

SMART Domains

Protein: ENSMUSP00000135600
Gene: ENSMUSG00000031979

Domain	Start	End	E-Value	Type
low complexity region	25	38	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176279

SMART Domains

Protein: ENSMUSP00000135022
Gene: ENSMUSG00000031979

Domain	Start	End	E-Value	Type
Pfam:COG2	15	101	1.5e-37	PFAM

Meta Mutation Damage Score

0.9502

Coding Region Coverage

1x: 99.6%
3x: 98.7%
10x: 96.9%
20x: 93.3%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akna	A	T	4: 63,373,468	S1144R	probably damaging	Het
Apbb1ip	T	C	2: 22,875,175	S623P	unknown	Het
Apex1	A	G	14: 50,926,257	T109A	probably benign	Het
Arhgef1	G	A	7: 24,919,272	G107S	probably damaging	Het
Cdc42bpa	A	G	1: 180,155,978		probably benign	Het
Dennd4c	G	A	4: 86,779,847	V191M	probably damaging	Het
Dscr3	A	G	16: 94,510,806	F95L	probably benign	Het
Dthd1	T	A	5: 62,827,129	H392Q	probably benign	Het
Dthd1	T	C	5: 62,888,023	V710A	probably benign	Het
Fam58b	T	C	11: 78,751,187	N159S	probably benign	Het
Galnt7	T	C	8: 57,532,624		probably benign	Het
Gm4868	A	G	5: 125,848,545		noncoding transcript	Het
Gpr179	T	C	11: 97,341,434	E648G	probably damaging	Het
Hk2	T	C	6: 82,736,676	E447G	possibly damaging	Het
Idi1	G	T	13: 8,885,932	A25S	probably benign	Het
Itgb3bp	T	C	4: 99,798,720	E76G	possibly damaging	Het
Khk	A	G	5: 30,927,057	D82G	probably benign	Het
Kif17	A	G	4: 138,291,510	S533G	probably benign	Het
Kmt2a	A	G	9: 44,830,499		probably benign	Het
Kmt5c	T	C	7: 4,746,256	F104S	probably damaging	Het
Lmf1	G	A	17: 25,654,471	V317M	probably damaging	Het
Mdh1	C	T	11: 21,559,281	V234I	probably benign	Het
Nbas	T	A	12: 13,279,414	I120N	possibly damaging	Het
Nfia	A	G	4: 98,063,022	H362R	probably damaging	Het
Nhlrc2	T	C	19: 56,588,271		probably null	Het
Nme5	A	G	18: 34,569,831	S135P	possibly damaging	Het
Nt5c2	A	G	19: 46,896,518	V252A	probably damaging	Het
Nufip2	T	C	11: 77,692,889	V543A	probably damaging	Het
Olfr1380	A	G	11: 49,564,091	T57A	probably damaging	Het
Olfr364-ps1	A	T	2: 37,146,823	I204F	possibly damaging	Het
Otog	T	C	7: 46,273,760	S1020P	possibly damaging	Het
Pear1	T	C	3: 87,751,921	H814R	possibly damaging	Het
Pkd1l1	A	G	11: 8,965,047		probably null	Het
Pla2g4a	T	A	1: 149,830,177	I711F	possibly damaging	Het
Ppig	G	A	2: 69,749,375	V418I	unknown	Het
Prg4	T	C	1: 150,452,000	Y234C	probably damaging	Het
Prmt9	G	A	8: 77,568,265	V413I	probably benign	Het
Rnf145	G	A	11: 44,531,293	V68M	possibly damaging	Het
Sepsecs	G	A	5: 52,664,274	R74C	probably damaging	Het
Sgsm1	A	G	5: 113,263,259	V580A	probably benign	Het
Sh3bp1	C	T	15: 78,901,161		probably benign	Het
Sox11	C	A	12: 27,341,502	G303C	probably damaging	Het
Usp54	C	A	14: 20,588,420	M197I	probably damaging	Het
Xylt1	T	G	7: 117,593,550	L361R	probably damaging	Het
Zfp512	A	G	5: 31,480,249	R505G	possibly damaging	Het

Other mutations in Cog2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01089:Cog2	APN	8	124545243	missense	probably benign	0.00
IGL01092:Cog2	APN	8	124545280	missense	probably damaging	1.00
IGL01150:Cog2	APN	8	124542891	missense	possibly damaging	0.62
IGL02052:Cog2	APN	8	124542888	critical splice acceptor site	probably null
IGL02308:Cog2	APN	8	124533212	critical splice acceptor site	probably null
IGL02543:Cog2	APN	8	124529959	missense	probably benign	0.09
IGL02978:Cog2	APN	8	124550336	missense	probably benign
IGL03008:Cog2	APN	8	124535392	splice site	probably benign
IGL03144:Cog2	APN	8	124541024	missense	probably damaging	0.98
kugge	UTSW	8	124550232	missense	probably damaging	1.00
Pelota	UTSW	8	124550306	missense	probably damaging	1.00
PIT4677001:Cog2	UTSW	8	124545271	missense	probably benign	0.22
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0110:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R0436:Cog2	UTSW	8	124548514	splice site	probably benign
R0450:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R1365:Cog2	UTSW	8	124540974	missense	probably damaging	0.97
R1661:Cog2	UTSW	8	124542890	missense	probably benign	0.20
R1698:Cog2	UTSW	8	124525683	missense	probably damaging	1.00
R1856:Cog2	UTSW	8	124551403	missense	possibly damaging	0.93
R2122:Cog2	UTSW	8	124528985	missense	possibly damaging	0.91
R2398:Cog2	UTSW	8	124529926	missense	probably benign	0.07
R4580:Cog2	UTSW	8	124545136	missense	probably benign	0.01
R4803:Cog2	UTSW	8	124535451	missense	probably damaging	0.96
R5316:Cog2	UTSW	8	124529040	missense	probably benign	0.14
R5346:Cog2	UTSW	8	124546631	missense	possibly damaging	0.94
R5394:Cog2	UTSW	8	124532529	missense	probably benign	0.00
R5395:Cog2	UTSW	8	124545221	missense	probably benign	0.00
R5738:Cog2	UTSW	8	124546038	missense	probably benign	0.03
R5861:Cog2	UTSW	8	124537878	missense	probably damaging	1.00
R5894:Cog2	UTSW	8	124545267	missense	probably benign	0.00
R5941:Cog2	UTSW	8	124546086	missense	probably benign
R6186:Cog2	UTSW	8	124546686	missense	probably damaging	1.00
R6400:Cog2	UTSW	8	124550306	missense	probably damaging	1.00
R6518:Cog2	UTSW	8	124527103	nonsense	probably null
R6558:Cog2	UTSW	8	124550232	missense	probably damaging	1.00
R6717:Cog2	UTSW	8	124525749	missense	probably damaging	1.00
R6902:Cog2	UTSW	8	124546691	missense	probably damaging	1.00
R6914:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R6942:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R7103:Cog2	UTSW	8	124541114	critical splice donor site	probably null
R7274:Cog2	UTSW	8	124535519	missense	possibly damaging	0.71
R7641:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R7674:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R8559:Cog2	UTSW	8	124542908	missense	probably benign	0.25
R9190:Cog2	UTSW	8	124533319	missense	probably damaging	1.00
R9307:Cog2	UTSW	8	124527098	critical splice acceptor site	probably null
R9629:Cog2	UTSW	8	124533386	missense	possibly damaging	0.67
X0026:Cog2	UTSW	8	124546020	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- GTATAATATTGACCGACCTTTGCCTC -3'
(R):5'- GCAAAGTCAACGCCACTGTC -3'

Sequencing Primer
(F):5'- GCCTCTCCTTTGTTAAAATGAGG -3'
(R):5'- ACTGTCCCCTCAGCCTGG -3'

Posted On

2015-04-06