Incidental Mutation 'R3855:Mdh1'
ID276121
Institutional Source Beutler Lab
Gene Symbol Mdh1
Ensembl Gene ENSMUSG00000020321
Gene Namemalate dehydrogenase 1, NAD (soluble)
SynonymsMor2, MDH-s, Mor-2, B230377B03Rik
MMRRC Submission 040901-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3855 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location21556787-21572367 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21559281 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 234 (V234I)
Ref Sequence ENSEMBL: ENSMUSP00000099938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102874] [ENSMUST00000125302]
Predicted Effect probably benign
Transcript: ENSMUST00000102874
AA Change: V234I

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099938
Gene: ENSMUSG00000020321
AA Change: V234I

DomainStartEndE-ValueType
Pfam:Ldh_1_N 5 153 7.3e-41 PFAM
Pfam:Ldh_1_C 156 331 1.2e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125302
SMART Domains Protein: ENSMUSP00000119816
Gene: ENSMUSG00000020321

DomainStartEndE-ValueType
Pfam:Ldh_1_N 5 153 5e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146146
Meta Mutation Damage Score 0.1553 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: This gene encodes an enzyme that catalyzes the NAD/NADH-dependent, reversible oxidation of malate to oxaloacetate in many metabolic pathways, including the citric acid cycle. Two main isozymes are known to exist in eukaryotic cells: one is found in the mitochondrial matrix and the other in the cytoplasm. This gene encodes the cytosolic isozyme, which plays a key role in the malate-aspartate shuttle that allows malate to pass through the mitochondrial membrane to be transformed into oxaloacetate for further cellular processes. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is localized in the peroxisomes. A pseudogene has been identified on chromosomes 12. [provided by RefSeq, Feb 2016]
PHENOTYPE: An ENU-induced mutation results in prenatal lethality in homozygotes and decreased enzyme activity in heterozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna A T 4: 63,373,468 S1144R probably damaging Het
Apbb1ip T C 2: 22,875,175 S623P unknown Het
Apex1 A G 14: 50,926,257 T109A probably benign Het
Arhgef1 G A 7: 24,919,272 G107S probably damaging Het
Cdc42bpa A G 1: 180,155,978 probably benign Het
Cog2 T C 8: 124,530,003 probably null Het
Dennd4c G A 4: 86,779,847 V191M probably damaging Het
Dscr3 A G 16: 94,510,806 F95L probably benign Het
Dthd1 T A 5: 62,827,129 H392Q probably benign Het
Dthd1 T C 5: 62,888,023 V710A probably benign Het
Fam58b T C 11: 78,751,187 N159S probably benign Het
Galnt7 T C 8: 57,532,624 probably benign Het
Gm4868 A G 5: 125,848,545 noncoding transcript Het
Gpr179 T C 11: 97,341,434 E648G probably damaging Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Itgb3bp T C 4: 99,798,720 E76G possibly damaging Het
Khk A G 5: 30,927,057 D82G probably benign Het
Kif17 A G 4: 138,291,510 S533G probably benign Het
Kmt2a A G 9: 44,830,499 probably benign Het
Kmt5c T C 7: 4,746,256 F104S probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Nbas T A 12: 13,279,414 I120N possibly damaging Het
Nfia A G 4: 98,063,022 H362R probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nme5 A G 18: 34,569,831 S135P possibly damaging Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Nufip2 T C 11: 77,692,889 V543A probably damaging Het
Olfr1380 A G 11: 49,564,091 T57A probably damaging Het
Olfr364-ps1 A T 2: 37,146,823 I204F possibly damaging Het
Otog T C 7: 46,273,760 S1020P possibly damaging Het
Pear1 T C 3: 87,751,921 H814R possibly damaging Het
Pkd1l1 A G 11: 8,965,047 probably null Het
Pla2g4a T A 1: 149,830,177 I711F possibly damaging Het
Ppig G A 2: 69,749,375 V418I unknown Het
Prg4 T C 1: 150,452,000 Y234C probably damaging Het
Prmt9 G A 8: 77,568,265 V413I probably benign Het
Rnf145 G A 11: 44,531,293 V68M possibly damaging Het
Sepsecs G A 5: 52,664,274 R74C probably damaging Het
Sgsm1 A G 5: 113,263,259 V580A probably benign Het
Sh3bp1 C T 15: 78,901,161 probably benign Het
Sox11 C A 12: 27,341,502 G303C probably damaging Het
Usp54 C A 14: 20,588,420 M197I probably damaging Het
Xylt1 T G 7: 117,593,550 L361R probably damaging Het
Zfp512 A G 5: 31,480,249 R505G possibly damaging Het
Other mutations in Mdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02171:Mdh1 APN 11 21557438 utr 3 prime probably benign
IGL02273:Mdh1 APN 11 21559786 missense probably benign 0.38
IGL03198:Mdh1 APN 11 21564168 missense probably damaging 1.00
PIT4480001:Mdh1 UTSW 11 21558538 missense probably damaging 1.00
R0771:Mdh1 UTSW 11 21557550 missense probably benign 0.27
R1016:Mdh1 UTSW 11 21559769 missense probably benign 0.01
R3854:Mdh1 UTSW 11 21559281 missense probably benign 0.31
R3886:Mdh1 UTSW 11 21559832 missense probably damaging 0.97
R4474:Mdh1 UTSW 11 21566624 missense possibly damaging 0.49
R4507:Mdh1 UTSW 11 21558470 missense probably benign 0.01
R4724:Mdh1 UTSW 11 21562957 missense probably damaging 1.00
R4986:Mdh1 UTSW 11 21558545 missense possibly damaging 0.85
R5472:Mdh1 UTSW 11 21559786 missense probably benign 0.38
R7088:Mdh1 UTSW 11 21558484 missense probably damaging 1.00
X0063:Mdh1 UTSW 11 21562870 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACAGTTGACAGCACAGCTTAG -3'
(R):5'- GCTTCCCTGTATTTAGTGTCACATG -3'

Sequencing Primer
(F):5'- AAGTAACATTTGGGGGCTCC -3'
(R):5'- TTTCAGCCATGCTTGCAG -3'
Posted On2015-04-06