Incidental Mutation 'R3856:Hspa4l'
ID276144
Institutional Source Beutler Lab
Gene Symbol Hspa4l
Ensembl Gene ENSMUSG00000025757
Gene Nameheat shock protein 4 like
Synonyms94kDa, Osp94, APG-1
MMRRC Submission 040902-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R3856 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location40744495-40796103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 40785389 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 698 (H698Q)
Ref Sequence ENSEMBL: ENSMUSP00000103721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108086] [ENSMUST00000203353] [ENSMUST00000204702]
Predicted Effect probably benign
Transcript: ENSMUST00000077083
AA Change: H719Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000076336
Gene: ENSMUSG00000025757
AA Change: H719Q

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108086
AA Change: H698Q

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103721
Gene: ENSMUSG00000025757
AA Change: H698Q

DomainStartEndE-ValueType
Pfam:HSP70 11 673 2.1e-171 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203353
SMART Domains Protein: ENSMUSP00000144787
Gene: ENSMUSG00000025757

DomainStartEndE-ValueType
Pfam:HSP70 3 570 6.2e-184 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204174
Predicted Effect probably benign
Transcript: ENSMUST00000204702
AA Change: H719Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000145468
Gene: ENSMUSG00000025757
AA Change: H719Q

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is heat shock inducible and may act as a chaperone. The encoded protein can protect the heat-shocked cell against the harmful effects of aggregated proteins. This gene is highly expressed in leukemia cells and may be a good target for therapeutic intervention. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display increased incidence of male infertility, due to reduced number of mature sperm and reduced sperm motility, and hydronephrosis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T C 14: 103,055,446 S469P possibly damaging Het
Adgrf5 A T 17: 43,447,036 N787I possibly damaging Het
Ank2 T C 3: 126,929,844 T945A probably benign Het
Aox4 T A 1: 58,253,934 I863N probably damaging Het
Ap3d1 A G 10: 80,712,185 I891T probably benign Het
Apex1 A G 14: 50,926,257 T109A probably benign Het
Arhgef1 G A 7: 24,919,272 G107S probably damaging Het
Atxn7l1 A G 12: 33,367,600 T587A probably damaging Het
Atxn7l3 T C 11: 102,293,903 D128G probably damaging Het
Cacna1h T C 17: 25,392,453 Y457C probably damaging Het
Ccdc60 A C 5: 116,172,455 C183G probably damaging Het
Cep131 G A 11: 120,067,185 R772* probably null Het
Cnst C T 1: 179,579,714 P109S probably benign Het
Crtc2 G T 3: 90,262,570 L509F probably damaging Het
Ctsr A T 13: 61,161,936 I153N possibly damaging Het
Dffa A T 4: 149,104,251 M1L possibly damaging Het
Dnajc16 G A 4: 141,763,653 R729* probably null Het
Eef2k T A 7: 120,899,371 C91* probably null Het
Eml5 T C 12: 98,816,024 D1336G probably damaging Het
F12 G A 13: 55,421,222 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fbxo40 A T 16: 36,969,083 L555Q probably damaging Het
Frmpd1 T C 4: 45,283,698 S840P probably damaging Het
Gadd45a C T 6: 67,037,005 probably null Het
Galnt7 T C 8: 57,532,624 probably benign Het
Gm5592 G A 7: 41,157,835 probably benign Het
Gpr171 T C 3: 59,098,085 T90A probably damaging Het
Gpr82 A T X: 13,665,338 T42S probably benign Het
H2-M10.6 T A 17: 36,812,504 I30N probably benign Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Kdm4a C T 4: 118,153,231 R605H probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Olfr608 T A 7: 103,470,660 V207E probably damaging Het
Pbp2 A G 6: 135,310,145 L68P probably benign Het
Pcnx3 G T 19: 5,678,967 T547K probably benign Het
Ppp1r12a T C 10: 108,253,501 probably benign Het
Prmt9 G A 8: 77,568,265 V413I probably benign Het
Pudp T C 18: 50,568,053 N203S probably benign Het
Rnf213 T C 11: 119,480,939 probably benign Het
Sall3 G A 18: 80,972,502 T737M probably damaging Het
Scn2b A G 9: 45,125,461 N89S possibly damaging Het
Sgsm1 A G 5: 113,263,259 V580A probably benign Het
Slc13a4 C A 6: 35,271,604 probably null Het
Slc4a4 A C 5: 89,232,839 S1015R probably benign Het
Slc8a1 T C 17: 81,648,374 T412A probably benign Het
Spag17 A T 3: 100,106,759 D2116V probably damaging Het
Trim55 T C 3: 19,672,956 F396L probably benign Het
Usp54 C A 14: 20,588,420 M197I probably damaging Het
Vmn1r189 A T 13: 22,102,269 F133I possibly damaging Het
Zfp735 T C 11: 73,711,456 S409P probably benign Het
Other mutations in Hspa4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Hspa4l APN 3 40753225 nonsense probably null
IGL02605:Hspa4l APN 3 40781623 missense probably benign 0.20
IGL02719:Hspa4l APN 3 40772658 missense possibly damaging 0.60
R0281:Hspa4l UTSW 3 40785408 splice site probably benign
R0398:Hspa4l UTSW 3 40756997 splice site probably benign
R0487:Hspa4l UTSW 3 40784326 missense possibly damaging 0.87
R0610:Hspa4l UTSW 3 40779400 missense probably benign 0.01
R0760:Hspa4l UTSW 3 40784723 nonsense probably null
R1491:Hspa4l UTSW 3 40786794 missense probably benign 0.00
R1720:Hspa4l UTSW 3 40781617 nonsense probably null
R1984:Hspa4l UTSW 3 40760401 missense probably damaging 1.00
R1986:Hspa4l UTSW 3 40760401 missense probably damaging 1.00
R2100:Hspa4l UTSW 3 40772658 missense possibly damaging 0.60
R3706:Hspa4l UTSW 3 40781693 missense possibly damaging 0.55
R3708:Hspa4l UTSW 3 40781693 missense possibly damaging 0.55
R3874:Hspa4l UTSW 3 40772642 missense probably damaging 1.00
R3890:Hspa4l UTSW 3 40781594 missense possibly damaging 0.90
R4256:Hspa4l UTSW 3 40746003 missense probably benign 0.03
R4364:Hspa4l UTSW 3 40766809 splice site probably null
R4365:Hspa4l UTSW 3 40766809 splice site probably null
R4366:Hspa4l UTSW 3 40766809 splice site probably null
R4493:Hspa4l UTSW 3 40768002 missense possibly damaging 0.77
R4494:Hspa4l UTSW 3 40753204 missense possibly damaging 0.86
R4954:Hspa4l UTSW 3 40785400 critical splice donor site probably null
R4994:Hspa4l UTSW 3 40745649 utr 5 prime probably benign
R5114:Hspa4l UTSW 3 40745765 missense possibly damaging 0.60
R5133:Hspa4l UTSW 3 40786747 missense possibly damaging 0.94
R5202:Hspa4l UTSW 3 40781569 missense probably benign 0.17
R5440:Hspa4l UTSW 3 40781576 missense probably damaging 1.00
R5635:Hspa4l UTSW 3 40745745 missense probably damaging 1.00
R5997:Hspa4l UTSW 3 40767979 missense probably damaging 0.99
R6012:Hspa4l UTSW 3 40781599 missense probably benign 0.09
R6515:Hspa4l UTSW 3 40781582 missense possibly damaging 0.82
R6589:Hspa4l UTSW 3 40757055 missense probably damaging 0.99
R7091:Hspa4l UTSW 3 40781592 missense probably benign 0.00
R7601:Hspa4l UTSW 3 40784356 critical splice donor site probably null
R8072:Hspa4l UTSW 3 40786746 missense probably damaging 0.98
Z1088:Hspa4l UTSW 3 40766993 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGTAAGGGCCATGTTAACAC -3'
(R):5'- GCCTCGGCTTTTAAATGTCC -3'

Sequencing Primer
(F):5'- GGTAAGGGCCATGTTAACACTTTTC -3'
(R):5'- CGGCTTTTAAATGTCCTGGATC -3'
Posted On2015-04-06