Incidental Mutation 'R3856:Crtc2'
ID276146
Institutional Source Beutler Lab
Gene Symbol Crtc2
Ensembl Gene ENSMUSG00000027936
Gene NameCREB regulated transcription coactivator 2
Synonyms
MMRRC Submission 040902-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R3856 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90254163-90264125 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 90262570 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 509 (L509F)
Ref Sequence ENSEMBL: ENSMUSP00000029545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029545] [ENSMUST00000098914] [ENSMUST00000129564] [ENSMUST00000184882]
Predicted Effect probably damaging
Transcript: ENSMUST00000029545
AA Change: L509F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029545
Gene: ENSMUSG00000027936
AA Change: L509F

DomainStartEndE-ValueType
Pfam:TORC_N 18 72 1.8e-20 PFAM
low complexity region 127 141 N/A INTRINSIC
Pfam:TORC_M 168 323 3.7e-71 PFAM
low complexity region 335 384 N/A INTRINSIC
low complexity region 391 416 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 484 494 N/A INTRINSIC
low complexity region 517 528 N/A INTRINSIC
Pfam:TORC_C 614 691 4.3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098914
SMART Domains Protein: ENSMUSP00000096514
Gene: ENSMUSG00000042404

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
uDENN 183 290 1.15e-29 SMART
DENN 324 508 5.26e-70 SMART
dDENN 573 647 1.75e-25 SMART
low complexity region 672 690 N/A INTRINSIC
low complexity region 740 752 N/A INTRINSIC
coiled coil region 902 928 N/A INTRINSIC
low complexity region 1022 1038 N/A INTRINSIC
low complexity region 1086 1096 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1131 1148 N/A INTRINSIC
low complexity region 1338 1350 N/A INTRINSIC
low complexity region 1424 1439 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123964
Predicted Effect probably benign
Transcript: ENSMUST00000129564
SMART Domains Protein: ENSMUSP00000117354
Gene: ENSMUSG00000042404

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
uDENN 172 279 1.15e-29 SMART
DENN 313 497 5.26e-70 SMART
dDENN 562 636 1.75e-25 SMART
low complexity region 661 679 N/A INTRINSIC
low complexity region 729 741 N/A INTRINSIC
coiled coil region 891 917 N/A INTRINSIC
low complexity region 1011 1027 N/A INTRINSIC
low complexity region 1075 1085 N/A INTRINSIC
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1120 1137 N/A INTRINSIC
low complexity region 1327 1339 N/A INTRINSIC
low complexity region 1413 1428 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149897
Predicted Effect probably benign
Transcript: ENSMUST00000156358
SMART Domains Protein: ENSMUSP00000118483
Gene: ENSMUSG00000042404

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
Blast:uDENN 39 97 9e-6 BLAST
Blast:uDENN 164 207 1e-22 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000184882
AA Change: L424F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139194
Gene: ENSMUSG00000027936
AA Change: L424F

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:TORC_M 83 239 6.5e-65 PFAM
low complexity region 250 299 N/A INTRINSIC
low complexity region 306 331 N/A INTRINSIC
low complexity region 347 354 N/A INTRINSIC
low complexity region 399 409 N/A INTRINSIC
low complexity region 432 443 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transducers of regulated cAMP response element-binding protein activity family of transcription coactivators. These proteins promote the transcription of genes targeted by the cAMP response element-binding protein, and therefore play an important role in many cellular processes. Under basal conditions the encoded protein is phosphorylated by AMP-activated protein kinase or the salt-inducible kinases and is sequestered in the cytoplasm. Upon activation by elevated cAMP or calcium, the encoded protein translocates to the nucleus and increases target gene expression. Single nucleotide polymorphisms in this gene may increase the risk of type 2 diabetes. A pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating corticosterone levels, hepatocyte secretion of glucose in response to glucagon, and glycogen levels in liver and muscle cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T C 14: 103,055,446 S469P possibly damaging Het
Adgrf5 A T 17: 43,447,036 N787I possibly damaging Het
Ank2 T C 3: 126,929,844 T945A probably benign Het
Aox4 T A 1: 58,253,934 I863N probably damaging Het
Ap3d1 A G 10: 80,712,185 I891T probably benign Het
Apex1 A G 14: 50,926,257 T109A probably benign Het
Arhgef1 G A 7: 24,919,272 G107S probably damaging Het
Atxn7l1 A G 12: 33,367,600 T587A probably damaging Het
Atxn7l3 T C 11: 102,293,903 D128G probably damaging Het
Cacna1h T C 17: 25,392,453 Y457C probably damaging Het
Ccdc60 A C 5: 116,172,455 C183G probably damaging Het
Cep131 G A 11: 120,067,185 R772* probably null Het
Cnst C T 1: 179,579,714 P109S probably benign Het
Ctsr A T 13: 61,161,936 I153N possibly damaging Het
Dffa A T 4: 149,104,251 M1L possibly damaging Het
Dnajc16 G A 4: 141,763,653 R729* probably null Het
Eef2k T A 7: 120,899,371 C91* probably null Het
Eml5 T C 12: 98,816,024 D1336G probably damaging Het
F12 G A 13: 55,421,222 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fbxo40 A T 16: 36,969,083 L555Q probably damaging Het
Frmpd1 T C 4: 45,283,698 S840P probably damaging Het
Gadd45a C T 6: 67,037,005 probably null Het
Galnt7 T C 8: 57,532,624 probably benign Het
Gm5592 G A 7: 41,157,835 probably benign Het
Gpr171 T C 3: 59,098,085 T90A probably damaging Het
Gpr82 A T X: 13,665,338 T42S probably benign Het
H2-M10.6 T A 17: 36,812,504 I30N probably benign Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Hspa4l C A 3: 40,785,389 H698Q probably benign Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Kdm4a C T 4: 118,153,231 R605H probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Olfr608 T A 7: 103,470,660 V207E probably damaging Het
Pbp2 A G 6: 135,310,145 L68P probably benign Het
Pcnx3 G T 19: 5,678,967 T547K probably benign Het
Ppp1r12a T C 10: 108,253,501 probably benign Het
Prmt9 G A 8: 77,568,265 V413I probably benign Het
Pudp T C 18: 50,568,053 N203S probably benign Het
Rnf213 T C 11: 119,480,939 probably benign Het
Sall3 G A 18: 80,972,502 T737M probably damaging Het
Scn2b A G 9: 45,125,461 N89S possibly damaging Het
Sgsm1 A G 5: 113,263,259 V580A probably benign Het
Slc13a4 C A 6: 35,271,604 probably null Het
Slc4a4 A C 5: 89,232,839 S1015R probably benign Het
Slc8a1 T C 17: 81,648,374 T412A probably benign Het
Spag17 A T 3: 100,106,759 D2116V probably damaging Het
Trim55 T C 3: 19,672,956 F396L probably benign Het
Usp54 C A 14: 20,588,420 M197I probably damaging Het
Vmn1r189 A T 13: 22,102,269 F133I possibly damaging Het
Zfp735 T C 11: 73,711,456 S409P probably benign Het
Other mutations in Crtc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Crtc2 APN 3 90260805 missense probably damaging 0.98
IGL01874:Crtc2 APN 3 90258508 missense probably damaging 1.00
IGL02220:Crtc2 APN 3 90259148 splice site probably benign
IGL02454:Crtc2 APN 3 90259167 missense probably benign 0.00
IGL02957:Crtc2 APN 3 90262533 missense probably damaging 1.00
R0190:Crtc2 UTSW 3 90259409 missense probably damaging 1.00
R0492:Crtc2 UTSW 3 90263497 missense probably damaging 0.99
R0707:Crtc2 UTSW 3 90263497 missense probably damaging 0.99
R0751:Crtc2 UTSW 3 90262633 nonsense probably null
R1184:Crtc2 UTSW 3 90262633 nonsense probably null
R1521:Crtc2 UTSW 3 90257383 missense probably benign 0.10
R4283:Crtc2 UTSW 3 90259236 splice site probably benign
R4747:Crtc2 UTSW 3 90260211 missense probably damaging 1.00
R5293:Crtc2 UTSW 3 90263564 missense probably benign
R5302:Crtc2 UTSW 3 90261018 missense probably damaging 1.00
R5314:Crtc2 UTSW 3 90261041 nonsense probably null
R6170:Crtc2 UTSW 3 90259600 missense probably benign
R6887:Crtc2 UTSW 3 90261071 missense probably damaging 0.99
R7067:Crtc2 UTSW 3 90260182 missense probably benign 0.44
R7506:Crtc2 UTSW 3 90259212 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTACAAGGTGGGGAACTC -3'
(R):5'- GTGACCACTCAAGTAACTGACC -3'

Sequencing Primer
(F):5'- CTTACAAGGTGGGGAACTCTTAAG -3'
(R):5'- CATCCCCCATTTCAGAACTATGAG -3'
Posted On2015-04-06