Mutagenetix > Incidental Mutation

Incidental Mutation 'R3856:Spag17'

276147

Institutional Source

Beutler Lab

Gene Symbol

Spag17

Ensembl Gene

ENSMUSG00000027867

Gene Name

sperm associated antigen 17

Synonyms

4931427F14Rik, PF6

MMRRC Submission

040902-MU

Accession Numbers

Genbank: NM_028892; MGI: 1921612

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3856 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99885406-100143322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 100106759 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 2116 (D2116V)

Ref Sequence

ENSEMBL: ENSMUSP00000134066 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164539]

AlphaFold

Q5S003

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137776

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145279

Predicted Effect

probably damaging
Transcript: ENSMUST00000164539
AA Change: D2116V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: D2116V

Domain	Start	End	E-Value	Type
low complexity region	155	170	N/A	INTRINSIC
low complexity region	384	400	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
coiled coil region	909	964	N/A	INTRINSIC
coiled coil region	1079	1120	N/A	INTRINSIC
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1192	1205	N/A	INTRINSIC
low complexity region	1209	1220	N/A	INTRINSIC
low complexity region	1223	1238	N/A	INTRINSIC
low complexity region	1394	1405	N/A	INTRINSIC
low complexity region	1931	1942	N/A	INTRINSIC
Pfam:PapD-like	2171	2277	1.2e-15	PFAM

Meta Mutation Damage Score

0.1140

Coding Region Coverage

1x: 99.6%
3x: 98.7%
10x: 96.7%
20x: 92.4%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acod1	T	C	14: 103,055,446 (GRCm38)	S469P	possibly damaging	Het
Adgrf5	A	T	17: 43,447,036 (GRCm38)	N787I	possibly damaging	Het
Ank2	T	C	3: 126,929,844 (GRCm38)	T945A	probably benign	Het
Aox4	T	A	1: 58,253,934 (GRCm38)	I863N	probably damaging	Het
Ap3d1	A	G	10: 80,712,185 (GRCm38)	I891T	probably benign	Het
Apex1	A	G	14: 50,926,257 (GRCm38)	T109A	probably benign	Het
Arhgef1	G	A	7: 24,919,272 (GRCm38)	G107S	probably damaging	Het
Atxn7l1	A	G	12: 33,367,600 (GRCm38)	T587A	probably damaging	Het
Atxn7l3	T	C	11: 102,293,903 (GRCm38)	D128G	probably damaging	Het
Cacna1h	T	C	17: 25,392,453 (GRCm38)	Y457C	probably damaging	Het
Ccdc60	A	C	5: 116,172,455 (GRCm38)	C183G	probably damaging	Het
Cep131	G	A	11: 120,067,185 (GRCm38)	R772*	probably null	Het
Cnst	C	T	1: 179,579,714 (GRCm38)	P109S	probably benign	Het
Crtc2	G	T	3: 90,262,570 (GRCm38)	L509F	probably damaging	Het
Ctsr	A	T	13: 61,161,936 (GRCm38)	I153N	possibly damaging	Het
Dffa	A	T	4: 149,104,251 (GRCm38)	M1L	possibly damaging	Het
Dnajc16	G	A	4: 141,763,653 (GRCm38)	R729*	probably null	Het
Eef2k	T	A	7: 120,899,371 (GRCm38)	C91*	probably null	Het
Eml5	T	C	12: 98,816,024 (GRCm38)	D1336G	probably damaging	Het
F12	G	A	13: 55,421,222 (GRCm38)		probably null	Het
Fam43b	G	C	4: 138,395,098 (GRCm38)	R304G	probably benign	Het
Fbxo40	A	T	16: 36,969,083 (GRCm38)	L555Q	probably damaging	Het
Frmpd1	T	C	4: 45,283,698 (GRCm38)	S840P	probably damaging	Het
Gadd45a	C	T	6: 67,037,005 (GRCm38)		probably null	Het
Galnt7	T	C	8: 57,532,624 (GRCm38)		probably benign	Het
Gm5592	G	A	7: 41,157,835 (GRCm38)		probably benign	Het
Gpr171	T	C	3: 59,098,085 (GRCm38)	T90A	probably damaging	Het
Gpr82	A	T	X: 13,665,338 (GRCm38)	T42S	probably benign	Het
H2-M10.6	T	A	17: 36,812,504 (GRCm38)	I30N	probably benign	Het
Hk2	T	C	6: 82,736,676 (GRCm38)	E447G	possibly damaging	Het
Hspa4l	C	A	3: 40,785,389 (GRCm38)	H698Q	probably benign	Het
Idi1	G	T	13: 8,885,932 (GRCm38)	A25S	probably benign	Het
Kdm4a	C	T	4: 118,153,231 (GRCm38)	R605H	probably damaging	Het
Nhlrc2	T	C	19: 56,588,271 (GRCm38)		probably null	Het
Nt5c2	A	G	19: 46,896,518 (GRCm38)	V252A	probably damaging	Het
Olfr608	T	A	7: 103,470,660 (GRCm38)	V207E	probably damaging	Het
Pbp2	A	G	6: 135,310,145 (GRCm38)	L68P	probably benign	Het
Pcnx3	G	T	19: 5,678,967 (GRCm38)	T547K	probably benign	Het
Ppp1r12a	T	C	10: 108,253,501 (GRCm38)		probably benign	Het
Prmt9	G	A	8: 77,568,265 (GRCm38)	V413I	probably benign	Het
Pudp	T	C	18: 50,568,053 (GRCm38)	N203S	probably benign	Het
Rnf213	T	C	11: 119,480,939 (GRCm38)		probably benign	Het
Sall3	G	A	18: 80,972,502 (GRCm38)	T737M	probably damaging	Het
Scn2b	A	G	9: 45,125,461 (GRCm38)	N89S	possibly damaging	Het
Sgsm1	A	G	5: 113,263,259 (GRCm38)	V580A	probably benign	Het
Slc13a4	C	A	6: 35,271,604 (GRCm38)		probably null	Het
Slc4a4	A	C	5: 89,232,839 (GRCm38)	S1015R	probably benign	Het
Slc8a1	T	C	17: 81,648,374 (GRCm38)	T412A	probably benign	Het
Trim55	T	C	3: 19,672,956 (GRCm38)	F396L	probably benign	Het
Usp54	C	A	14: 20,588,420 (GRCm38)	M197I	probably damaging	Het
Vmn1r189	A	T	13: 22,102,269 (GRCm38)	F133I	possibly damaging	Het
Zfp735	T	C	11: 73,711,456 (GRCm38)	S409P	probably benign	Het

Other mutations in Spag17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01096:Spag17	APN	3	100,063,375 (GRCm38)	missense	probably benign	0.00
IGL01143:Spag17	APN	3	99,939,298 (GRCm38)	missense	probably benign	0.00
IGL01329:Spag17	APN	3	100,095,549 (GRCm38)	missense	probably benign	0.16
IGL01393:Spag17	APN	3	100,027,610 (GRCm38)	missense	possibly damaging	0.53
IGL01617:Spag17	APN	3	100,109,508 (GRCm38)	missense	possibly damaging	0.65
IGL01705:Spag17	APN	3	100,022,730 (GRCm38)	missense	probably benign	0.01
IGL01928:Spag17	APN	3	99,940,074 (GRCm38)	splice site	probably benign
IGL01981:Spag17	APN	3	100,058,833 (GRCm38)	missense	probably benign	0.03
IGL02435:Spag17	APN	3	99,982,444 (GRCm38)	missense	possibly damaging	0.53
IGL02452:Spag17	APN	3	100,027,391 (GRCm38)	missense	probably benign	0.00
IGL02465:Spag17	APN	3	100,075,871 (GRCm38)	missense	probably damaging	0.96
IGL02615:Spag17	APN	3	100,072,085 (GRCm38)	missense	probably benign	0.09
IGL02751:Spag17	APN	3	100,010,794 (GRCm38)	nonsense	probably null
IGL02803:Spag17	APN	3	100,109,397 (GRCm38)	missense	probably benign
IGL02898:Spag17	APN	3	100,101,386 (GRCm38)	missense	probably benign	0.00
IGL03037:Spag17	APN	3	100,072,170 (GRCm38)	splice site	probably null
IGL03068:Spag17	APN	3	100,080,205 (GRCm38)	missense	probably benign	0.35
IGL03131:Spag17	APN	3	100,010,759 (GRCm38)	missense	possibly damaging	0.85
IGL03224:Spag17	APN	3	100,010,840 (GRCm38)	missense	possibly damaging	0.53
FR4342:Spag17	UTSW	3	100,056,252 (GRCm38)	small insertion	probably benign
FR4342:Spag17	UTSW	3	100,056,249 (GRCm38)	small insertion	probably benign
FR4548:Spag17	UTSW	3	100,056,254 (GRCm38)	small insertion	probably benign
FR4589:Spag17	UTSW	3	100,056,258 (GRCm38)	small insertion	probably benign
FR4589:Spag17	UTSW	3	100,056,245 (GRCm38)	small insertion	probably benign
FR4737:Spag17	UTSW	3	100,056,257 (GRCm38)	small insertion	probably benign
FR4976:Spag17	UTSW	3	100,056,255 (GRCm38)	small insertion	probably benign
FR4976:Spag17	UTSW	3	100,056,254 (GRCm38)	small insertion	probably benign
N/A:Spag17	UTSW	3	99,982,254 (GRCm38)	splice site	probably benign
PIT4504001:Spag17	UTSW	3	100,103,110 (GRCm38)	critical splice acceptor site	probably null
PIT4514001:Spag17	UTSW	3	100,013,211 (GRCm38)	missense	possibly damaging	0.53
R0107:Spag17	UTSW	3	100,050,787 (GRCm38)	missense	possibly damaging	0.72
R0230:Spag17	UTSW	3	100,106,827 (GRCm38)	missense	probably benign	0.08
R0243:Spag17	UTSW	3	100,085,368 (GRCm38)	missense	probably benign	0.04
R0321:Spag17	UTSW	3	100,101,403 (GRCm38)	missense	probably damaging	0.99
R0375:Spag17	UTSW	3	100,027,590 (GRCm38)	missense	probably benign
R0417:Spag17	UTSW	3	100,065,554 (GRCm38)	missense	probably benign	0.11
R0490:Spag17	UTSW	3	99,982,411 (GRCm38)	missense	probably damaging	0.97
R0537:Spag17	UTSW	3	100,125,302 (GRCm38)	missense	probably damaging	0.98
R0714:Spag17	UTSW	3	100,080,156 (GRCm38)	missense	probably damaging	0.97
R0844:Spag17	UTSW	3	100,004,785 (GRCm38)	missense	probably benign
R0919:Spag17	UTSW	3	100,071,943 (GRCm38)	splice site	probably benign
R0926:Spag17	UTSW	3	100,072,116 (GRCm38)	missense	probably benign
R1037:Spag17	UTSW	3	100,103,117 (GRCm38)	missense	probably benign	0.01
R1075:Spag17	UTSW	3	100,093,676 (GRCm38)	missense	probably damaging	0.99
R1109:Spag17	UTSW	3	100,027,351 (GRCm38)	missense	possibly damaging	0.86
R1213:Spag17	UTSW	3	100,095,638 (GRCm38)	missense	probably benign	0.01
R1221:Spag17	UTSW	3	99,982,268 (GRCm38)	missense	possibly damaging	0.72
R1576:Spag17	UTSW	3	99,939,363 (GRCm38)	missense	possibly damaging	0.73
R1586:Spag17	UTSW	3	100,021,752 (GRCm38)	missense	possibly damaging	0.53
R1768:Spag17	UTSW	3	100,027,352 (GRCm38)	missense	possibly damaging	0.53
R1782:Spag17	UTSW	3	100,010,754 (GRCm38)	missense	probably benign	0.02
R1789:Spag17	UTSW	3	99,939,356 (GRCm38)	missense	possibly damaging	0.73
R1945:Spag17	UTSW	3	99,939,982 (GRCm38)	missense	probably benign
R2065:Spag17	UTSW	3	100,013,208 (GRCm38)	missense	probably benign	0.03
R2118:Spag17	UTSW	3	100,049,240 (GRCm38)	missense	possibly damaging	0.72
R2265:Spag17	UTSW	3	100,061,866 (GRCm38)	splice site	probably null
R2266:Spag17	UTSW	3	100,061,866 (GRCm38)	splice site	probably null
R2267:Spag17	UTSW	3	100,061,866 (GRCm38)	splice site	probably null
R2268:Spag17	UTSW	3	100,061,866 (GRCm38)	splice site	probably null
R2271:Spag17	UTSW	3	100,106,797 (GRCm38)	missense	probably damaging	1.00
R2389:Spag17	UTSW	3	100,106,837 (GRCm38)	missense	probably benign	0.27
R2420:Spag17	UTSW	3	100,027,619 (GRCm38)	missense	probably benign
R2422:Spag17	UTSW	3	100,027,619 (GRCm38)	missense	probably benign
R2423:Spag17	UTSW	3	100,103,456 (GRCm38)	missense	probably benign
R3407:Spag17	UTSW	3	100,085,299 (GRCm38)	missense	probably benign	0.09
R3801:Spag17	UTSW	3	100,053,853 (GRCm38)	missense	possibly damaging	0.53
R4021:Spag17	UTSW	3	100,049,230 (GRCm38)	missense	probably benign	0.00
R4022:Spag17	UTSW	3	100,049,230 (GRCm38)	missense	probably benign	0.00
R4408:Spag17	UTSW	3	100,103,378 (GRCm38)	missense	probably benign
R4468:Spag17	UTSW	3	100,085,366 (GRCm38)	missense	probably damaging	0.98
R4540:Spag17	UTSW	3	100,088,381 (GRCm38)	missense	probably damaging	1.00
R4621:Spag17	UTSW	3	100,103,243 (GRCm38)	missense	probably benign	0.08
R4622:Spag17	UTSW	3	100,103,243 (GRCm38)	missense	probably benign	0.08
R4756:Spag17	UTSW	3	100,103,385 (GRCm38)	missense	possibly damaging	0.68
R4797:Spag17	UTSW	3	99,984,479 (GRCm38)	missense	possibly damaging	0.70
R4855:Spag17	UTSW	3	100,063,333 (GRCm38)	missense	probably benign	0.02
R4887:Spag17	UTSW	3	100,050,831 (GRCm38)	missense	probably damaging	1.00
R4962:Spag17	UTSW	3	100,027,623 (GRCm38)	missense	probably benign
R5030:Spag17	UTSW	3	100,085,341 (GRCm38)	nonsense	probably null
R5042:Spag17	UTSW	3	100,072,149 (GRCm38)	missense	probably damaging	1.00
R5074:Spag17	UTSW	3	100,080,118 (GRCm38)	missense	possibly damaging	0.94
R5195:Spag17	UTSW	3	100,101,388 (GRCm38)	missense	probably benign	0.16
R5200:Spag17	UTSW	3	100,063,471 (GRCm38)	nonsense	probably null
R5267:Spag17	UTSW	3	100,061,948 (GRCm38)	missense	probably damaging	0.98
R5360:Spag17	UTSW	3	100,109,410 (GRCm38)	missense	probably benign	0.00
R5444:Spag17	UTSW	3	100,056,152 (GRCm38)	missense	probably benign	0.06
R5498:Spag17	UTSW	3	100,103,345 (GRCm38)	missense	possibly damaging	0.83
R5503:Spag17	UTSW	3	100,027,244 (GRCm38)	missense	possibly damaging	0.72
R5540:Spag17	UTSW	3	100,056,272 (GRCm38)	missense	possibly damaging	0.91
R5547:Spag17	UTSW	3	100,056,152 (GRCm38)	missense	probably benign	0.06
R5575:Spag17	UTSW	3	100,053,822 (GRCm38)	missense	possibly damaging	0.85
R5629:Spag17	UTSW	3	100,080,119 (GRCm38)	missense	probably benign	0.33
R5639:Spag17	UTSW	3	100,056,166 (GRCm38)	missense	probably damaging	1.00
R5842:Spag17	UTSW	3	99,939,250 (GRCm38)	missense	possibly damaging	0.85
R5976:Spag17	UTSW	3	100,095,791 (GRCm38)	nonsense	probably null
R6082:Spag17	UTSW	3	100,124,185 (GRCm38)	missense	possibly damaging	0.46
R6228:Spag17	UTSW	3	100,022,602 (GRCm38)	missense	probably benign	0.33
R6254:Spag17	UTSW	3	100,065,585 (GRCm38)	missense	probably benign	0.03
R6321:Spag17	UTSW	3	100,088,427 (GRCm38)	missense	probably benign	0.05
R6446:Spag17	UTSW	3	100,103,132 (GRCm38)	missense	probably benign
R6687:Spag17	UTSW	3	100,092,950 (GRCm38)	missense	probably benign	0.07
R6853:Spag17	UTSW	3	100,013,235 (GRCm38)	missense	possibly damaging	0.86
R6946:Spag17	UTSW	3	100,004,683 (GRCm38)	missense	possibly damaging	0.53
R6953:Spag17	UTSW	3	100,034,975 (GRCm38)	missense	possibly damaging	0.53
R7038:Spag17	UTSW	3	99,984,609 (GRCm38)	missense	probably benign	0.00
R7084:Spag17	UTSW	3	99,939,270 (GRCm38)	missense	probably benign	0.18
R7126:Spag17	UTSW	3	100,101,435 (GRCm38)	missense	probably benign	0.00
R7144:Spag17	UTSW	3	100,027,401 (GRCm38)	splice site	probably null
R7198:Spag17	UTSW	3	100,095,572 (GRCm38)	missense	probably benign	0.02
R7318:Spag17	UTSW	3	99,939,983 (GRCm38)	missense	probably benign	0.00
R7403:Spag17	UTSW	3	99,939,375 (GRCm38)	missense	possibly damaging	0.53
R7409:Spag17	UTSW	3	100,027,231 (GRCm38)	missense	possibly damaging	0.73
R7409:Spag17	UTSW	3	100,034,159 (GRCm38)	missense	probably benign	0.00
R7537:Spag17	UTSW	3	99,939,247 (GRCm38)	missense	possibly damaging	0.96
R7609:Spag17	UTSW	3	100,095,595 (GRCm38)	nonsense	probably null
R7772:Spag17	UTSW	3	100,080,118 (GRCm38)	missense	probably damaging	0.98
R7842:Spag17	UTSW	3	100,053,858 (GRCm38)	missense	probably benign	0.18
R7963:Spag17	UTSW	3	100,022,638 (GRCm38)	missense	probably benign	0.02
R8168:Spag17	UTSW	3	100,034,984 (GRCm38)	missense	possibly damaging	0.96
R8291:Spag17	UTSW	3	100,060,850 (GRCm38)	missense	probably benign
R8347:Spag17	UTSW	3	100,027,641 (GRCm38)	missense	probably benign
R8383:Spag17	UTSW	3	100,085,392 (GRCm38)	missense	probably damaging	0.98
R8474:Spag17	UTSW	3	100,027,270 (GRCm38)	missense	probably benign	0.00
R8528:Spag17	UTSW	3	100,124,185 (GRCm38)	missense	possibly damaging	0.46
R8804:Spag17	UTSW	3	99,967,190 (GRCm38)	missense	probably benign
R8809:Spag17	UTSW	3	99,982,422 (GRCm38)	missense	probably benign	0.33
R8818:Spag17	UTSW	3	100,013,227 (GRCm38)	missense	probably benign	0.02
R8830:Spag17	UTSW	3	100,125,435 (GRCm38)	missense	possibly damaging	0.77
R8890:Spag17	UTSW	3	100,004,678 (GRCm38)	missense	possibly damaging	0.73
R9008:Spag17	UTSW	3	100,027,626 (GRCm38)	missense	possibly damaging	0.73
R9095:Spag17	UTSW	3	100,004,776 (GRCm38)	missense	possibly damaging	0.86
R9143:Spag17	UTSW	3	100,027,590 (GRCm38)	missense	probably benign
R9182:Spag17	UTSW	3	100,058,842 (GRCm38)	missense	possibly damaging	0.92
R9211:Spag17	UTSW	3	100,125,298 (GRCm38)	critical splice acceptor site	probably benign
R9344:Spag17	UTSW	3	100,103,477 (GRCm38)	missense	probably benign	0.01
R9354:Spag17	UTSW	3	100,027,589 (GRCm38)	missense	probably benign
R9527:Spag17	UTSW	3	100,063,461 (GRCm38)	missense	probably damaging	1.00
R9658:Spag17	UTSW	3	100,027,616 (GRCm38)	missense	possibly damaging	0.93
R9738:Spag17	UTSW	3	100,027,210 (GRCm38)	missense	possibly damaging	0.53
X0025:Spag17	UTSW	3	100,101,451 (GRCm38)	missense	probably benign	0.31
Z1088:Spag17	UTSW	3	100,095,630 (GRCm38)	missense	probably benign	0.09
Z1176:Spag17	UTSW	3	100,012,993 (GRCm38)	missense	probably benign	0.18
Z1177:Spag17	UTSW	3	100,088,399 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAATGCTCTCAGGGCTCTC -3'
(R):5'- AATCTCAGAAGCTGGTGCCAG -3'

Sequencing Primer
(F):5'- TCTCAGGGCTCTCGGTAC -3'
(R):5'- TCCTGTGGGAGAATGGTAAGG -3'

Posted On

2015-04-06