Mutagenetix > Incidental Mutation

Incidental Mutation 'R3856:Dnajc16'

276151

Institutional Source

Beutler Lab

Gene Symbol

Dnajc16

Ensembl Gene

ENSMUSG00000040697

Gene Name

DnaJ heat shock protein family (Hsp40) member C16

Synonyms

4732437J24Rik, 2900037O03Rik

MMRRC Submission

040902-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.736) question?

Stock #

R3856 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

141760189-141790931 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 141763653 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 729 (R729*)

Ref Sequence

ENSEMBL: ENSMUSP00000048714 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038014] [ENSMUST00000038161]

AlphaFold

Q80TN4

PDB Structure

Solution structure of the J domain of the pseudo DnaJ protein, mouse hypothetical mKIAA0962 [SOLUTION NMR]

Predicted Effect

probably null
Transcript: ENSMUST00000038014
AA Change: R729*

SMART Domains

Protein: ENSMUSP00000048714
Gene: ENSMUSG00000040697
AA Change: R729*

Domain	Start	End	E-Value	Type
DnaJ	28	85	4.5e-30	SMART
Pfam:Thioredoxin	142	243	4.4e-8	PFAM
low complexity region	537	549	N/A	INTRINSIC
low complexity region	730	750	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000038161

SMART Domains

Protein: ENSMUSP00000040853
Gene: ENSMUSG00000040706

Domain	Start	End	E-Value	Type
low complexity region	44	62	N/A	INTRINSIC
Pfam:Arginase	77	351	9.8e-85	PFAM

Meta Mutation Damage Score

0.9712

Coding Region Coverage

1x: 99.6%
3x: 98.7%
10x: 96.7%
20x: 92.4%

Validation Efficiency

100% (57/57)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acod1	T	C	14: 103,055,446	S469P	possibly damaging	Het
Adgrf5	A	T	17: 43,447,036	N787I	possibly damaging	Het
Ank2	T	C	3: 126,929,844	T945A	probably benign	Het
Aox4	T	A	1: 58,253,934	I863N	probably damaging	Het
Ap3d1	A	G	10: 80,712,185	I891T	probably benign	Het
Apex1	A	G	14: 50,926,257	T109A	probably benign	Het
Arhgef1	G	A	7: 24,919,272	G107S	probably damaging	Het
Atxn7l1	A	G	12: 33,367,600	T587A	probably damaging	Het
Atxn7l3	T	C	11: 102,293,903	D128G	probably damaging	Het
Cacna1h	T	C	17: 25,392,453	Y457C	probably damaging	Het
Ccdc60	A	C	5: 116,172,455	C183G	probably damaging	Het
Cep131	G	A	11: 120,067,185	R772*	probably null	Het
Cnst	C	T	1: 179,579,714	P109S	probably benign	Het
Crtc2	G	T	3: 90,262,570	L509F	probably damaging	Het
Ctsr	A	T	13: 61,161,936	I153N	possibly damaging	Het
Dffa	A	T	4: 149,104,251	M1L	possibly damaging	Het
Eef2k	T	A	7: 120,899,371	C91*	probably null	Het
Eml5	T	C	12: 98,816,024	D1336G	probably damaging	Het
F12	G	A	13: 55,421,222		probably null	Het
Fam43b	G	C	4: 138,395,098	R304G	probably benign	Het
Fbxo40	A	T	16: 36,969,083	L555Q	probably damaging	Het
Frmpd1	T	C	4: 45,283,698	S840P	probably damaging	Het
Gadd45a	C	T	6: 67,037,005		probably null	Het
Galnt7	T	C	8: 57,532,624		probably benign	Het
Gm5592	G	A	7: 41,157,835		probably benign	Het
Gpr171	T	C	3: 59,098,085	T90A	probably damaging	Het
Gpr82	A	T	X: 13,665,338	T42S	probably benign	Het
H2-M10.6	T	A	17: 36,812,504	I30N	probably benign	Het
Hk2	T	C	6: 82,736,676	E447G	possibly damaging	Het
Hspa4l	C	A	3: 40,785,389	H698Q	probably benign	Het
Idi1	G	T	13: 8,885,932	A25S	probably benign	Het
Kdm4a	C	T	4: 118,153,231	R605H	probably damaging	Het
Nhlrc2	T	C	19: 56,588,271		probably null	Het
Nt5c2	A	G	19: 46,896,518	V252A	probably damaging	Het
Olfr608	T	A	7: 103,470,660	V207E	probably damaging	Het
Pbp2	A	G	6: 135,310,145	L68P	probably benign	Het
Pcnx3	G	T	19: 5,678,967	T547K	probably benign	Het
Ppp1r12a	T	C	10: 108,253,501		probably benign	Het
Prmt9	G	A	8: 77,568,265	V413I	probably benign	Het
Pudp	T	C	18: 50,568,053	N203S	probably benign	Het
Rnf213	T	C	11: 119,480,939		probably benign	Het
Sall3	G	A	18: 80,972,502	T737M	probably damaging	Het
Scn2b	A	G	9: 45,125,461	N89S	possibly damaging	Het
Sgsm1	A	G	5: 113,263,259	V580A	probably benign	Het
Slc13a4	C	A	6: 35,271,604		probably null	Het
Slc4a4	A	C	5: 89,232,839	S1015R	probably benign	Het
Slc8a1	T	C	17: 81,648,374	T412A	probably benign	Het
Spag17	A	T	3: 100,106,759	D2116V	probably damaging	Het
Trim55	T	C	3: 19,672,956	F396L	probably benign	Het
Usp54	C	A	14: 20,588,420	M197I	probably damaging	Het
Vmn1r189	A	T	13: 22,102,269	F133I	possibly damaging	Het
Zfp735	T	C	11: 73,711,456	S409P	probably benign	Het

Other mutations in Dnajc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00495:Dnajc16	APN	4	141763563	splice site	probably null
IGL00840:Dnajc16	APN	4	141768003	missense	probably damaging	1.00
IGL01503:Dnajc16	APN	4	141763697	missense	possibly damaging	0.65
IGL01919:Dnajc16	APN	4	141774629	missense	probably benign	0.06
IGL02065:Dnajc16	APN	4	141776933	missense	probably damaging	1.00
IGL02544:Dnajc16	APN	4	141764647	missense	probably damaging	1.00
IGL03028:Dnajc16	APN	4	141767732	nonsense	probably null
PIT4418001:Dnajc16	UTSW	4	141770949	missense	probably damaging	0.99
PIT4585001:Dnajc16	UTSW	4	141764685	missense	probably damaging	1.00
R0071:Dnajc16	UTSW	4	141768007	missense	probably benign
R0415:Dnajc16	UTSW	4	141789048	nonsense	probably null
R0532:Dnajc16	UTSW	4	141789009	missense	probably damaging	1.00
R1418:Dnajc16	UTSW	4	141767741	nonsense	probably null
R2959:Dnajc16	UTSW	4	141766545	nonsense	probably null
R3025:Dnajc16	UTSW	4	141774611	missense	probably benign
R3796:Dnajc16	UTSW	4	141767737	missense	probably benign
R3854:Dnajc16	UTSW	4	141763653	nonsense	probably null
R4661:Dnajc16	UTSW	4	141763548	missense	probably damaging	1.00
R4841:Dnajc16	UTSW	4	141774625	missense	probably damaging	1.00
R4842:Dnajc16	UTSW	4	141774625	missense	probably damaging	1.00
R5116:Dnajc16	UTSW	4	141767969	nonsense	probably null
R5126:Dnajc16	UTSW	4	141774509	missense	probably benign	0.01
R5140:Dnajc16	UTSW	4	141764683	missense	possibly damaging	0.85
R5275:Dnajc16	UTSW	4	141767928	missense	possibly damaging	0.82
R5295:Dnajc16	UTSW	4	141767928	missense	possibly damaging	0.82
R5891:Dnajc16	UTSW	4	141775392	missense	probably benign
R6888:Dnajc16	UTSW	4	141776992	missense	probably benign	0.24
R7062:Dnajc16	UTSW	4	141766690	missense	probably damaging	1.00
R7441:Dnajc16	UTSW	4	141763813	missense	probably damaging	1.00
R7684:Dnajc16	UTSW	4	141774568	missense	probably benign	0.02
R8843:Dnajc16	UTSW	4	141764691	missense	possibly damaging	0.87
R8924:Dnajc16	UTSW	4	141766707	nonsense	probably null
R9005:Dnajc16	UTSW	4	141764634	missense	possibly damaging	0.95
R9053:Dnajc16	UTSW	4	141783060	missense	probably benign	0.28
R9550:Dnajc16	UTSW	4	141767747	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- GAAAGGTCTTCTAGCCATGGC -3'
(R):5'- AGAGTTTGCTCAGGATGCG -3'

Sequencing Primer
(F):5'- TGGAGACTCTCTTAAAATCCCTG -3'
(R):5'- AGGATGCGGCCCCGATC -3'

Posted On

2015-04-06