Incidental Mutation 'R3856:Dffa'
ID276152
Institutional Source Beutler Lab
Gene Symbol Dffa
Ensembl Gene ENSMUSG00000028974
Gene NameDNA fragmentation factor, alpha subunit
SynonymsICAD-L, A330085O09Rik, ICAD-S, DFF35, Dff45
MMRRC Submission 040902-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R3856 (G1)
Quality Score170
Status Validated
Chromosome4
Chromosomal Location149104146-149120647 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 149104251 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000099505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030816] [ENSMUST00000103216] [ENSMUST00000103217] [ENSMUST00000134747]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030816
AA Change: M1L

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030816
Gene: ENSMUSG00000028974
AA Change: M1L

DomainStartEndE-ValueType
CAD 19 94 1.79e-47 SMART
Pfam:DFF-C 100 264 1.1e-74 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103216
AA Change: M1L

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099505
Gene: ENSMUSG00000028974
AA Change: M1L

DomainStartEndE-ValueType
CAD 19 94 1.79e-47 SMART
Pfam:DFF-C 100 264 2.2e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103217
SMART Domains Protein: ENSMUSP00000099506
Gene: ENSMUSG00000028975

DomainStartEndE-ValueType
Pfam:Pex14_N 25 135 9.8e-25 PFAM
coiled coil region 163 198 N/A INTRINSIC
low complexity region 247 262 N/A INTRINSIC
low complexity region 265 275 N/A INTRINSIC
low complexity region 316 341 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128067
Predicted Effect probably benign
Transcript: ENSMUST00000134747
SMART Domains Protein: ENSMUSP00000116791
Gene: ENSMUSG00000028975

DomainStartEndE-ValueType
Pfam:Pex14_N 25 66 2.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154860
Meta Mutation Damage Score 0.7103 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apoptosis is a cell death process that removes toxic and/or useless cells during mammalian development. The apoptotic process is accompanied by shrinkage and fragmentation of the cells and nuclei and degradation of the chromosomal DNA into nucleosomal units. DNA fragmentation factor (DFF) is a heterodimeric protein of 40-kD (DFFB) and 45-kD (DFFA) subunits. DFFA is the substrate for caspase-3 and triggers DNA fragmentation during apoptosis. DFF becomes activated when DFFA is cleaved by caspase-3. The cleaved fragments of DFFA dissociate from DFFB, the active component of DFF. DFFB has been found to trigger both DNA fragmentation and chromatin condensation during apoptosis. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show increased resistance to apoptosis in response to several apoptotic stimuli, enhanced spatial learning and memory, higher granule cell density and total granule cell number in the dentate gyrus, and resistance to kainic acid-induced CA3 neuronal cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T C 14: 103,055,446 S469P possibly damaging Het
Adgrf5 A T 17: 43,447,036 N787I possibly damaging Het
Ank2 T C 3: 126,929,844 T945A probably benign Het
Aox4 T A 1: 58,253,934 I863N probably damaging Het
Ap3d1 A G 10: 80,712,185 I891T probably benign Het
Apex1 A G 14: 50,926,257 T109A probably benign Het
Arhgef1 G A 7: 24,919,272 G107S probably damaging Het
Atxn7l1 A G 12: 33,367,600 T587A probably damaging Het
Atxn7l3 T C 11: 102,293,903 D128G probably damaging Het
Cacna1h T C 17: 25,392,453 Y457C probably damaging Het
Ccdc60 A C 5: 116,172,455 C183G probably damaging Het
Cep131 G A 11: 120,067,185 R772* probably null Het
Cnst C T 1: 179,579,714 P109S probably benign Het
Crtc2 G T 3: 90,262,570 L509F probably damaging Het
Ctsr A T 13: 61,161,936 I153N possibly damaging Het
Dnajc16 G A 4: 141,763,653 R729* probably null Het
Eef2k T A 7: 120,899,371 C91* probably null Het
Eml5 T C 12: 98,816,024 D1336G probably damaging Het
F12 G A 13: 55,421,222 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fbxo40 A T 16: 36,969,083 L555Q probably damaging Het
Frmpd1 T C 4: 45,283,698 S840P probably damaging Het
Gadd45a C T 6: 67,037,005 probably null Het
Galnt7 T C 8: 57,532,624 probably benign Het
Gm5592 G A 7: 41,157,835 probably benign Het
Gpr171 T C 3: 59,098,085 T90A probably damaging Het
Gpr82 A T X: 13,665,338 T42S probably benign Het
H2-M10.6 T A 17: 36,812,504 I30N probably benign Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Hspa4l C A 3: 40,785,389 H698Q probably benign Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Kdm4a C T 4: 118,153,231 R605H probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Olfr608 T A 7: 103,470,660 V207E probably damaging Het
Pbp2 A G 6: 135,310,145 L68P probably benign Het
Pcnx3 G T 19: 5,678,967 T547K probably benign Het
Ppp1r12a T C 10: 108,253,501 probably benign Het
Prmt9 G A 8: 77,568,265 V413I probably benign Het
Pudp T C 18: 50,568,053 N203S probably benign Het
Rnf213 T C 11: 119,480,939 probably benign Het
Sall3 G A 18: 80,972,502 T737M probably damaging Het
Scn2b A G 9: 45,125,461 N89S possibly damaging Het
Sgsm1 A G 5: 113,263,259 V580A probably benign Het
Slc13a4 C A 6: 35,271,604 probably null Het
Slc4a4 A C 5: 89,232,839 S1015R probably benign Het
Slc8a1 T C 17: 81,648,374 T412A probably benign Het
Spag17 A T 3: 100,106,759 D2116V probably damaging Het
Trim55 T C 3: 19,672,956 F396L probably benign Het
Usp54 C A 14: 20,588,420 M197I probably damaging Het
Vmn1r189 A T 13: 22,102,269 F133I possibly damaging Het
Zfp735 T C 11: 73,711,456 S409P probably benign Het
Other mutations in Dffa
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1475:Dffa UTSW 4 149117478 missense probably damaging 1.00
R1672:Dffa UTSW 4 149106245 missense probably damaging 1.00
R1950:Dffa UTSW 4 149104382 missense probably benign 0.05
R5185:Dffa UTSW 4 149117430 missense probably benign 0.04
R5238:Dffa UTSW 4 149104303 missense probably benign 0.04
R5280:Dffa UTSW 4 149117934 missense probably benign 0.00
R5514:Dffa UTSW 4 149106315 critical splice donor site probably null
X0065:Dffa UTSW 4 149119131 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGATTAGCCGCCACTAGAAC -3'
(R):5'- CCAGGAATCTGTCAATCACTGG -3'

Sequencing Primer
(F):5'- TAGAACTACATCTCCCGGCGTG -3'
(R):5'- TGTCAATCACTGGACCCACGTG -3'
Posted On2015-04-06