Incidental Mutation 'R3856:Hk2'
ID276157
Institutional Source Beutler Lab
Gene Symbol Hk2
Ensembl Gene ENSMUSG00000000628
Gene Namehexokinase 2
SynonymsHKII
MMRRC Submission 040902-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3856 (G1)
Quality Score164
Status Validated
Chromosome6
Chromosomal Location82725025-82774454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82736676 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 447 (E447G)
Ref Sequence ENSEMBL: ENSMUSP00000125986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000642] [ENSMUST00000170833]
Predicted Effect probably benign
Transcript: ENSMUST00000000642
AA Change: E475G

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000000642
Gene: ENSMUSG00000000628
AA Change: E475G

DomainStartEndE-ValueType
Pfam:Hexokinase_1 21 220 9.8e-78 PFAM
Pfam:Hexokinase_2 225 459 4.9e-85 PFAM
Pfam:Hexokinase_1 469 668 6.4e-80 PFAM
Pfam:Hexokinase_2 673 907 8.7e-85 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170833
AA Change: E447G

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125986
Gene: ENSMUSG00000000628
AA Change: E447G

DomainStartEndE-ValueType
Pfam:Hexokinase_1 1 193 5.5e-89 PFAM
Pfam:Hexokinase_2 195 434 5.3e-107 PFAM
Pfam:Hexokinase_1 436 641 5.9e-91 PFAM
Pfam:Hexokinase_2 643 882 1.3e-109 PFAM
Meta Mutation Damage Score 0.1254 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes hexokinase 2, the predominant form found in skeletal muscle. It localizes to the outer membrane of mitochondria. Expression of this gene is insulin-responsive, and studies in rat suggest that it is involved in the increased rate of glycolysis seen in rapidly growing cancer cells. [provided by RefSeq, Apr 2009]
PHENOTYPE: Embryos homozygous for a knock-out mutation are severely growth retarded and die around E8.5. Interestingly, heterozygous mutant mice are viable and fertile, develop normally and do not exhibit impaired insulin action or glucose tolerance even when challenged with a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T C 14: 103,055,446 S469P possibly damaging Het
Adgrf5 A T 17: 43,447,036 N787I possibly damaging Het
Ank2 T C 3: 126,929,844 T945A probably benign Het
Aox4 T A 1: 58,253,934 I863N probably damaging Het
Ap3d1 A G 10: 80,712,185 I891T probably benign Het
Apex1 A G 14: 50,926,257 T109A probably benign Het
Arhgef1 G A 7: 24,919,272 G107S probably damaging Het
Atxn7l1 A G 12: 33,367,600 T587A probably damaging Het
Atxn7l3 T C 11: 102,293,903 D128G probably damaging Het
Cacna1h T C 17: 25,392,453 Y457C probably damaging Het
Ccdc60 A C 5: 116,172,455 C183G probably damaging Het
Cep131 G A 11: 120,067,185 R772* probably null Het
Cnst C T 1: 179,579,714 P109S probably benign Het
Crtc2 G T 3: 90,262,570 L509F probably damaging Het
Ctsr A T 13: 61,161,936 I153N possibly damaging Het
Dffa A T 4: 149,104,251 M1L possibly damaging Het
Dnajc16 G A 4: 141,763,653 R729* probably null Het
Eef2k T A 7: 120,899,371 C91* probably null Het
Eml5 T C 12: 98,816,024 D1336G probably damaging Het
F12 G A 13: 55,421,222 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fbxo40 A T 16: 36,969,083 L555Q probably damaging Het
Frmpd1 T C 4: 45,283,698 S840P probably damaging Het
Gadd45a C T 6: 67,037,005 probably null Het
Galnt7 T C 8: 57,532,624 probably benign Het
Gm5592 G A 7: 41,157,835 probably benign Het
Gpr171 T C 3: 59,098,085 T90A probably damaging Het
Gpr82 A T X: 13,665,338 T42S probably benign Het
H2-M10.6 T A 17: 36,812,504 I30N probably benign Het
Hspa4l C A 3: 40,785,389 H698Q probably benign Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Kdm4a C T 4: 118,153,231 R605H probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Olfr608 T A 7: 103,470,660 V207E probably damaging Het
Pbp2 A G 6: 135,310,145 L68P probably benign Het
Pcnx3 G T 19: 5,678,967 T547K probably benign Het
Ppp1r12a T C 10: 108,253,501 probably benign Het
Prmt9 G A 8: 77,568,265 V413I probably benign Het
Pudp T C 18: 50,568,053 N203S probably benign Het
Rnf213 T C 11: 119,480,939 probably benign Het
Sall3 G A 18: 80,972,502 T737M probably damaging Het
Scn2b A G 9: 45,125,461 N89S possibly damaging Het
Sgsm1 A G 5: 113,263,259 V580A probably benign Het
Slc13a4 C A 6: 35,271,604 probably null Het
Slc4a4 A C 5: 89,232,839 S1015R probably benign Het
Slc8a1 T C 17: 81,648,374 T412A probably benign Het
Spag17 A T 3: 100,106,759 D2116V probably damaging Het
Trim55 T C 3: 19,672,956 F396L probably benign Het
Usp54 C A 14: 20,588,420 M197I probably damaging Het
Vmn1r189 A T 13: 22,102,269 F133I possibly damaging Het
Zfp735 T C 11: 73,711,456 S409P probably benign Het
Other mutations in Hk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Hk2 APN 6 82729552 missense possibly damaging 0.93
IGL01484:Hk2 APN 6 82736730 missense probably damaging 1.00
IGL01786:Hk2 APN 6 82739553 missense probably benign 0.13
IGL02164:Hk2 APN 6 82743939 splice site probably null
IGL02293:Hk2 APN 6 82743975 missense probably benign 0.00
IGL02861:Hk2 APN 6 82760158 missense possibly damaging 0.73
IGL03029:Hk2 APN 6 82738333 missense probably damaging 1.00
IGL03063:Hk2 APN 6 82739649 missense probably damaging 1.00
IGL03063:Hk2 APN 6 82749232 missense probably benign 0.23
IGL02799:Hk2 UTSW 6 82760238 missense probably damaging 1.00
PIT4243001:Hk2 UTSW 6 82730877 missense probably damaging 1.00
R0069:Hk2 UTSW 6 82736528 critical splice donor site probably null
R0081:Hk2 UTSW 6 82734976 splice site probably benign
R0981:Hk2 UTSW 6 82743968 missense probably damaging 1.00
R1234:Hk2 UTSW 6 82760248 missense possibly damaging 0.95
R1239:Hk2 UTSW 6 82749308 missense probably damaging 1.00
R1695:Hk2 UTSW 6 82744951 missense probably damaging 0.99
R1891:Hk2 UTSW 6 82749283 missense probably benign 0.01
R2338:Hk2 UTSW 6 82731115 missense probably damaging 1.00
R3854:Hk2 UTSW 6 82736676 missense possibly damaging 0.87
R3855:Hk2 UTSW 6 82736676 missense possibly damaging 0.87
R3887:Hk2 UTSW 6 82734961 missense possibly damaging 0.72
R4382:Hk2 UTSW 6 82735341 missense probably null 1.00
R4684:Hk2 UTSW 6 82739648 missense probably damaging 1.00
R4705:Hk2 UTSW 6 82739650 missense possibly damaging 0.95
R4735:Hk2 UTSW 6 82744974 missense probably benign 0.40
R5014:Hk2 UTSW 6 82743955 missense possibly damaging 0.73
R5552:Hk2 UTSW 6 82730823 missense possibly damaging 0.87
R5914:Hk2 UTSW 6 82736634 missense probably benign
R6212:Hk2 UTSW 6 82728842 missense probably benign 0.02
R6276:Hk2 UTSW 6 82743366 missense probably benign 0.05
R6369:Hk2 UTSW 6 82736753 missense probably damaging 1.00
R7175:Hk2 UTSW 6 82734849 missense probably benign 0.00
R7340:Hk2 UTSW 6 82728892 missense probably benign 0.00
R7383:Hk2 UTSW 6 82749295 missense probably damaging 1.00
R7417:Hk2 UTSW 6 82743345 missense probably damaging 1.00
R7481:Hk2 UTSW 6 82760169 missense probably benign 0.09
R7495:Hk2 UTSW 6 82727365 missense probably damaging 1.00
R7757:Hk2 UTSW 6 82742915 missense possibly damaging 0.88
R8023:Hk2 UTSW 6 82728809 missense probably benign 0.00
R8100:Hk2 UTSW 6 82730878 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ATTCAAGGTGGTCCTGTACAG -3'
(R):5'- TGTCACAGTTTTGCCAAGCG -3'

Sequencing Primer
(F):5'- TAAGCACATCAGGGGTTTCC -3'
(R):5'- TTGCCAAGCGTCTCCATAAGG -3'
Posted On2015-04-06