Incidental Mutation 'R3856:Olfr608'
List |< first << previous [record 36 of 53] next >> last >|
ID276163
Institutional Source Beutler Lab
Gene Symbol Olfr608
Ensembl Gene ENSMUSG00000073948
Gene Nameolfactory receptor 608
SynonymsGA_x6K02T2PBJ9-6191595-6192545, MOR26-3
MMRRC Submission 040902-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R3856 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103469877-103471358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103470660 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 207 (V207E)
Ref Sequence ENSEMBL: ENSMUSP00000150595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000213546]
Predicted Effect probably damaging
Transcript: ENSMUST00000098199
AA Change: V207E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095801
Gene: ENSMUSG00000073948
AA Change: V207E

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 4.7e-101 PFAM
Pfam:7TM_GPCR_Srsx 36 308 7.1e-8 PFAM
Pfam:7tm_1 42 293 6.4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213546
AA Change: V207E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T C 14: 103,055,446 S469P possibly damaging Het
Adgrf5 A T 17: 43,447,036 N787I possibly damaging Het
Ank2 T C 3: 126,929,844 T945A probably benign Het
Aox4 T A 1: 58,253,934 I863N probably damaging Het
Ap3d1 A G 10: 80,712,185 I891T probably benign Het
Apex1 A G 14: 50,926,257 T109A probably benign Het
Arhgef1 G A 7: 24,919,272 G107S probably damaging Het
Atxn7l1 A G 12: 33,367,600 T587A probably damaging Het
Atxn7l3 T C 11: 102,293,903 D128G probably damaging Het
Cacna1h T C 17: 25,392,453 Y457C probably damaging Het
Ccdc60 A C 5: 116,172,455 C183G probably damaging Het
Cep131 G A 11: 120,067,185 R772* probably null Het
Cnst C T 1: 179,579,714 P109S probably benign Het
Crtc2 G T 3: 90,262,570 L509F probably damaging Het
Ctsr A T 13: 61,161,936 I153N possibly damaging Het
Dffa A T 4: 149,104,251 M1L possibly damaging Het
Dnajc16 G A 4: 141,763,653 R729* probably null Het
Eef2k T A 7: 120,899,371 C91* probably null Het
Eml5 T C 12: 98,816,024 D1336G probably damaging Het
F12 G A 13: 55,421,222 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fbxo40 A T 16: 36,969,083 L555Q probably damaging Het
Frmpd1 T C 4: 45,283,698 S840P probably damaging Het
Gadd45a C T 6: 67,037,005 probably null Het
Galnt7 T C 8: 57,532,624 probably benign Het
Gm5592 G A 7: 41,157,835 probably benign Het
Gpr171 T C 3: 59,098,085 T90A probably damaging Het
Gpr82 A T X: 13,665,338 T42S probably benign Het
H2-M10.6 T A 17: 36,812,504 I30N probably benign Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Hspa4l C A 3: 40,785,389 H698Q probably benign Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Kdm4a C T 4: 118,153,231 R605H probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Pbp2 A G 6: 135,310,145 L68P probably benign Het
Pcnx3 G T 19: 5,678,967 T547K probably benign Het
Ppp1r12a T C 10: 108,253,501 probably benign Het
Prmt9 G A 8: 77,568,265 V413I probably benign Het
Pudp T C 18: 50,568,053 N203S probably benign Het
Rnf213 T C 11: 119,480,939 probably benign Het
Sall3 G A 18: 80,972,502 T737M probably damaging Het
Scn2b A G 9: 45,125,461 N89S possibly damaging Het
Sgsm1 A G 5: 113,263,259 V580A probably benign Het
Slc13a4 C A 6: 35,271,604 probably null Het
Slc4a4 A C 5: 89,232,839 S1015R probably benign Het
Slc8a1 T C 17: 81,648,374 T412A probably benign Het
Spag17 A T 3: 100,106,759 D2116V probably damaging Het
Trim55 T C 3: 19,672,956 F396L probably benign Het
Usp54 C A 14: 20,588,420 M197I probably damaging Het
Vmn1r189 A T 13: 22,102,269 F133I possibly damaging Het
Zfp735 T C 11: 73,711,456 S409P probably benign Het
Other mutations in Olfr608
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01735:Olfr608 APN 7 103470323 missense probably damaging 1.00
IGL02428:Olfr608 APN 7 103470383 missense probably benign 0.03
IGL02832:Olfr608 APN 7 103470698 missense probably benign 0.00
R0546:Olfr608 UTSW 7 103470700 missense possibly damaging 0.65
R1518:Olfr608 UTSW 7 103470042 start codon destroyed probably null 0.98
R1696:Olfr608 UTSW 7 103470177 missense probably benign 0.18
R1735:Olfr608 UTSW 7 103470146 missense possibly damaging 0.83
R2927:Olfr608 UTSW 7 103470882 missense probably damaging 1.00
R4374:Olfr608 UTSW 7 103470071 missense probably damaging 0.97
R4375:Olfr608 UTSW 7 103470071 missense probably damaging 0.97
R4377:Olfr608 UTSW 7 103470071 missense probably damaging 0.97
R5059:Olfr608 UTSW 7 103470281 nonsense probably null
R5174:Olfr608 UTSW 7 103470403 missense probably benign 0.14
R5579:Olfr608 UTSW 7 103470914 missense probably damaging 1.00
R6762:Olfr608 UTSW 7 103470389 missense probably benign 0.02
R7888:Olfr608 UTSW 7 103470799 nonsense probably null
R7971:Olfr608 UTSW 7 103470799 nonsense probably null
R8150:Olfr608 UTSW 7 103470252 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGCCATGGTTATTAAGCTGG -3'
(R):5'- CACTTGGAGGCACATTCTTGC -3'

Sequencing Primer
(F):5'- AGCCATGGTTATTAAGCTGGGTGTAG -3'
(R):5'- CACATTCTTGCCAATGCGATGAG -3'
Posted On2015-04-06