Incidental Mutation 'R3856:Eef2k'
ID276164
Institutional Source Beutler Lab
Gene Symbol Eef2k
Ensembl Gene ENSMUSG00000035064
Gene Nameeukaryotic elongation factor-2 kinase
SynonymseEF-2K
MMRRC Submission 040902-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R3856 (G1)
Quality Score196
Status Validated
Chromosome7
Chromosomal Location120842831-120907450 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 120899371 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 91 (C91*)
Ref Sequence ENSEMBL: ENSMUSP00000114782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047875] [ENSMUST00000106487] [ENSMUST00000106488] [ENSMUST00000106489] [ENSMUST00000146482]
Predicted Effect probably null
Transcript: ENSMUST00000047875
AA Change: C630*
SMART Domains Protein: ENSMUSP00000046595
Gene: ENSMUSG00000035064
AA Change: C630*

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 525 562 7.2e-5 PFAM
Pfam:Sel1 564 608 2.9e-3 PFAM
Pfam:Sel1 609 645 1.3e-1 PFAM
Pfam:Sel1 665 699 1.2e-2 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106487
AA Change: C66*
SMART Domains Protein: ENSMUSP00000102096
Gene: ENSMUSG00000035064
AA Change: C66*

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 1e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
Pfam:Sel1 432 472 1.8e-3 PFAM
Pfam:Sel1 474 518 7.2e-3 PFAM
Pfam:Sel1 519 555 8e-2 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106488
AA Change: C630*
SMART Domains Protein: ENSMUSP00000102097
Gene: ENSMUSG00000035064
AA Change: C630*

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 522 562 1.1e-3 PFAM
Pfam:Sel1 564 608 3.9e-3 PFAM
Pfam:Sel1 609 645 4.8e-2 PFAM
Pfam:Sel1 664 699 4.6e-3 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106489
AA Change: C630*
SMART Domains Protein: ENSMUSP00000102098
Gene: ENSMUSG00000035064
AA Change: C630*

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 522 562 1.1e-3 PFAM
Pfam:Sel1 564 608 3.9e-3 PFAM
Pfam:Sel1 609 645 4.8e-2 PFAM
Pfam:Sel1 664 699 4.6e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128813
Predicted Effect probably null
Transcript: ENSMUST00000146482
AA Change: C91*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved protein kinase in the calmodulin-mediated signaling pathway that links activation of cell surface receptors to cell division. This kinase is involved in the regulation of protein synthesis. It phosphorylates eukaryotic elongation factor 2 (EEF2) and thus inhibits the EEF2 function. The activity of this kinase is increased in many cancers and may be a valid target for anti-cancer treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired regulation of ovarian follicular degeneration and apoptosis, prolonged estrus, and increased ovarian follicle numbers in aged females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T C 14: 103,055,446 S469P possibly damaging Het
Adgrf5 A T 17: 43,447,036 N787I possibly damaging Het
Ank2 T C 3: 126,929,844 T945A probably benign Het
Aox4 T A 1: 58,253,934 I863N probably damaging Het
Ap3d1 A G 10: 80,712,185 I891T probably benign Het
Apex1 A G 14: 50,926,257 T109A probably benign Het
Arhgef1 G A 7: 24,919,272 G107S probably damaging Het
Atxn7l1 A G 12: 33,367,600 T587A probably damaging Het
Atxn7l3 T C 11: 102,293,903 D128G probably damaging Het
Cacna1h T C 17: 25,392,453 Y457C probably damaging Het
Ccdc60 A C 5: 116,172,455 C183G probably damaging Het
Cep131 G A 11: 120,067,185 R772* probably null Het
Cnst C T 1: 179,579,714 P109S probably benign Het
Crtc2 G T 3: 90,262,570 L509F probably damaging Het
Ctsr A T 13: 61,161,936 I153N possibly damaging Het
Dffa A T 4: 149,104,251 M1L possibly damaging Het
Dnajc16 G A 4: 141,763,653 R729* probably null Het
Eml5 T C 12: 98,816,024 D1336G probably damaging Het
F12 G A 13: 55,421,222 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fbxo40 A T 16: 36,969,083 L555Q probably damaging Het
Frmpd1 T C 4: 45,283,698 S840P probably damaging Het
Gadd45a C T 6: 67,037,005 probably null Het
Galnt7 T C 8: 57,532,624 probably benign Het
Gm5592 G A 7: 41,157,835 probably benign Het
Gpr171 T C 3: 59,098,085 T90A probably damaging Het
Gpr82 A T X: 13,665,338 T42S probably benign Het
H2-M10.6 T A 17: 36,812,504 I30N probably benign Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Hspa4l C A 3: 40,785,389 H698Q probably benign Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Kdm4a C T 4: 118,153,231 R605H probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Olfr608 T A 7: 103,470,660 V207E probably damaging Het
Pbp2 A G 6: 135,310,145 L68P probably benign Het
Pcnx3 G T 19: 5,678,967 T547K probably benign Het
Ppp1r12a T C 10: 108,253,501 probably benign Het
Prmt9 G A 8: 77,568,265 V413I probably benign Het
Pudp T C 18: 50,568,053 N203S probably benign Het
Rnf213 T C 11: 119,480,939 probably benign Het
Sall3 G A 18: 80,972,502 T737M probably damaging Het
Scn2b A G 9: 45,125,461 N89S possibly damaging Het
Sgsm1 A G 5: 113,263,259 V580A probably benign Het
Slc13a4 C A 6: 35,271,604 probably null Het
Slc4a4 A C 5: 89,232,839 S1015R probably benign Het
Slc8a1 T C 17: 81,648,374 T412A probably benign Het
Spag17 A T 3: 100,106,759 D2116V probably damaging Het
Trim55 T C 3: 19,672,956 F396L probably benign Het
Usp54 C A 14: 20,588,420 M197I probably damaging Het
Vmn1r189 A T 13: 22,102,269 F133I possibly damaging Het
Zfp735 T C 11: 73,711,456 S409P probably benign Het
Other mutations in Eef2k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Eef2k APN 7 120884815 unclassified probably benign
IGL01481:Eef2k APN 7 120895218 missense probably benign 0.23
IGL01935:Eef2k APN 7 120885831 missense probably damaging 1.00
IGL03109:Eef2k APN 7 120891726 missense probably damaging 1.00
R0458:Eef2k UTSW 7 120903290 missense probably damaging 0.99
R1639:Eef2k UTSW 7 120885828 missense probably damaging 1.00
R1986:Eef2k UTSW 7 120873346 missense possibly damaging 0.92
R3419:Eef2k UTSW 7 120885870 missense probably damaging 0.99
R3610:Eef2k UTSW 7 120889235 missense probably benign
R3707:Eef2k UTSW 7 120884712 missense probably damaging 1.00
R4024:Eef2k UTSW 7 120858598 missense probably benign 0.01
R4535:Eef2k UTSW 7 120858599 nonsense probably null
R4885:Eef2k UTSW 7 120891932 missense probably benign
R5137:Eef2k UTSW 7 120885422 missense probably damaging 0.99
R5137:Eef2k UTSW 7 120885423 missense probably damaging 1.00
R5501:Eef2k UTSW 7 120889248 missense probably benign 0.00
R5610:Eef2k UTSW 7 120886782 missense probably benign 0.00
R5633:Eef2k UTSW 7 120873290 intron probably benign
R7002:Eef2k UTSW 7 120891932 missense probably benign
R7166:Eef2k UTSW 7 120884772 missense probably damaging 1.00
R7254:Eef2k UTSW 7 120889265 missense probably benign 0.11
R7466:Eef2k UTSW 7 120903484 utr 3 prime probably null
R7486:Eef2k UTSW 7 120858570 missense probably benign
R7538:Eef2k UTSW 7 120891992 missense probably benign 0.29
R7593:Eef2k UTSW 7 120889268 critical splice donor site probably null
R7675:Eef2k UTSW 7 120858504 missense probably benign
R7815:Eef2k UTSW 7 120858570 missense probably benign
R7898:Eef2k UTSW 7 120895218 missense probably damaging 1.00
R7981:Eef2k UTSW 7 120895218 missense probably damaging 1.00
Z1177:Eef2k UTSW 7 120858453 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTCACTTAGATGTGGTGGCC -3'
(R):5'- TGAGAACTATAGACCTTCACCAGC -3'

Sequencing Primer
(F):5'- GCCTTTGGTACTATAGTTTGTAGCTC -3'
(R):5'- CCTCACCTGATCTTTGGGGG -3'
Posted On2015-04-06