Incidental Mutation 'R3856:Ap3d1'
ID 276168
Institutional Source Beutler Lab
Gene Symbol Ap3d1
Ensembl Gene ENSMUSG00000020198
Gene Name adaptor-related protein complex 3, delta 1 subunit
Synonyms mBLVR1, Bolvr
MMRRC Submission 040902-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.931) question?
Stock # R3856 (G1)
Quality Score 160
Status Validated
Chromosome 10
Chromosomal Location 80542790-80578098 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80548019 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 891 (I891T)
Ref Sequence ENSEMBL: ENSMUSP00000020420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020420] [ENSMUST00000218610]
AlphaFold O54774
Predicted Effect probably benign
Transcript: ENSMUST00000020420
AA Change: I891T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: I891T

DomainStartEndE-ValueType
Pfam:Adaptin_N 32 583 6.6e-153 PFAM
Pfam:Cnd1 130 292 2.1e-8 PFAM
low complexity region 629 642 N/A INTRINSIC
BLVR 660 803 5.3e-80 SMART
low complexity region 835 861 N/A INTRINSIC
low complexity region 871 881 N/A INTRINSIC
coiled coil region 910 933 N/A INTRINSIC
low complexity region 947 964 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218125
Predicted Effect probably benign
Transcript: ENSMUST00000218610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219816
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T C 14: 103,292,882 (GRCm39) S469P possibly damaging Het
Adgrf5 A T 17: 43,757,927 (GRCm39) N787I possibly damaging Het
Ank2 T C 3: 126,723,493 (GRCm39) T945A probably benign Het
Aox4 T A 1: 58,293,093 (GRCm39) I863N probably damaging Het
Apex1 A G 14: 51,163,714 (GRCm39) T109A probably benign Het
Arhgef1 G A 7: 24,618,697 (GRCm39) G107S probably damaging Het
Atxn7l1 A G 12: 33,417,599 (GRCm39) T587A probably damaging Het
Atxn7l3 T C 11: 102,184,729 (GRCm39) D128G probably damaging Het
Cacna1h T C 17: 25,611,427 (GRCm39) Y457C probably damaging Het
Ccdc60 A C 5: 116,310,514 (GRCm39) C183G probably damaging Het
Cep131 G A 11: 119,958,011 (GRCm39) R772* probably null Het
Cnst C T 1: 179,407,279 (GRCm39) P109S probably benign Het
Crtc2 G T 3: 90,169,877 (GRCm39) L509F probably damaging Het
Ctsr A T 13: 61,309,750 (GRCm39) I153N possibly damaging Het
Dffa A T 4: 149,188,708 (GRCm39) M1L possibly damaging Het
Dnajc16 G A 4: 141,490,964 (GRCm39) R729* probably null Het
Eef2k T A 7: 120,498,594 (GRCm39) C91* probably null Het
Eml5 T C 12: 98,782,283 (GRCm39) D1336G probably damaging Het
F12 G A 13: 55,569,035 (GRCm39) probably null Het
Fam43b G C 4: 138,122,409 (GRCm39) R304G probably benign Het
Fbxo40 A T 16: 36,789,445 (GRCm39) L555Q probably damaging Het
Frmpd1 T C 4: 45,283,698 (GRCm39) S840P probably damaging Het
Gadd45a C T 6: 67,013,989 (GRCm39) probably null Het
Galnt7 T C 8: 57,985,658 (GRCm39) probably benign Het
Gm5592 G A 7: 40,807,259 (GRCm39) probably benign Het
Gpr171 T C 3: 59,005,506 (GRCm39) T90A probably damaging Het
Gpr82 A T X: 13,531,577 (GRCm39) T42S probably benign Het
H2-M10.6 T A 17: 37,123,396 (GRCm39) I30N probably benign Het
Hk2 T C 6: 82,713,657 (GRCm39) E447G possibly damaging Het
Hspa4l C A 3: 40,739,821 (GRCm39) H698Q probably benign Het
Idi1 G T 13: 8,935,968 (GRCm39) A25S probably benign Het
Kdm4a C T 4: 118,010,428 (GRCm39) R605H probably damaging Het
Nhlrc2 T C 19: 56,576,703 (GRCm39) probably null Het
Nt5c2 A G 19: 46,884,957 (GRCm39) V252A probably damaging Het
Or52ae7 T A 7: 103,119,867 (GRCm39) V207E probably damaging Het
Pbp2 A G 6: 135,287,143 (GRCm39) L68P probably benign Het
Pcnx3 G T 19: 5,728,995 (GRCm39) T547K probably benign Het
Ppp1r12a T C 10: 108,089,362 (GRCm39) probably benign Het
Prmt9 G A 8: 78,294,894 (GRCm39) V413I probably benign Het
Pudp T C 18: 50,701,124 (GRCm39) N203S probably benign Het
Rnf213 T C 11: 119,371,765 (GRCm39) probably benign Het
Sall3 G A 18: 81,015,717 (GRCm39) T737M probably damaging Het
Scn2b A G 9: 45,036,759 (GRCm39) N89S possibly damaging Het
Sgsm1 A G 5: 113,411,125 (GRCm39) V580A probably benign Het
Slc13a4 C A 6: 35,248,539 (GRCm39) probably null Het
Slc4a4 A C 5: 89,380,698 (GRCm39) S1015R probably benign Het
Slc8a1 T C 17: 81,955,803 (GRCm39) T412A probably benign Het
Spag17 A T 3: 100,014,075 (GRCm39) D2116V probably damaging Het
Trim55 T C 3: 19,727,120 (GRCm39) F396L probably benign Het
Usp54 C A 14: 20,638,488 (GRCm39) M197I probably damaging Het
Vmn1r189 A T 13: 22,286,439 (GRCm39) F133I possibly damaging Het
Zfp735 T C 11: 73,602,282 (GRCm39) S409P probably benign Het
Other mutations in Ap3d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ap3d1 APN 10 80,577,813 (GRCm39) missense probably benign 0.00
IGL00827:Ap3d1 APN 10 80,549,393 (GRCm39) missense possibly damaging 0.92
IGL01668:Ap3d1 APN 10 80,554,993 (GRCm39) missense possibly damaging 0.95
IGL01934:Ap3d1 APN 10 80,545,092 (GRCm39) nonsense probably null
IGL03404:Ap3d1 APN 10 80,565,871 (GRCm39) missense probably damaging 1.00
christian UTSW 10 80,565,876 (GRCm39) missense probably damaging 1.00
Particle UTSW 10 80,546,328 (GRCm39) splice site probably null
vesicle UTSW 10 80,559,661 (GRCm39) missense probably damaging 1.00
R0119:Ap3d1 UTSW 10 80,559,449 (GRCm39) splice site probably benign
R0197:Ap3d1 UTSW 10 80,565,876 (GRCm39) missense probably damaging 1.00
R0356:Ap3d1 UTSW 10 80,563,812 (GRCm39) missense probably damaging 1.00
R0372:Ap3d1 UTSW 10 80,559,401 (GRCm39) missense probably damaging 1.00
R0491:Ap3d1 UTSW 10 80,555,075 (GRCm39) missense probably damaging 1.00
R0636:Ap3d1 UTSW 10 80,555,216 (GRCm39) nonsense probably null
R0792:Ap3d1 UTSW 10 80,544,313 (GRCm39) missense probably benign
R0942:Ap3d1 UTSW 10 80,568,789 (GRCm39) splice site probably benign
R1015:Ap3d1 UTSW 10 80,552,323 (GRCm39) missense probably damaging 1.00
R1023:Ap3d1 UTSW 10 80,550,092 (GRCm39) missense probably damaging 1.00
R1170:Ap3d1 UTSW 10 80,568,674 (GRCm39) splice site probably benign
R1540:Ap3d1 UTSW 10 80,551,775 (GRCm39) missense probably benign 0.00
R1639:Ap3d1 UTSW 10 80,565,844 (GRCm39) missense probably damaging 0.98
R1664:Ap3d1 UTSW 10 80,553,571 (GRCm39) nonsense probably null
R1669:Ap3d1 UTSW 10 80,546,670 (GRCm39) unclassified probably benign
R1839:Ap3d1 UTSW 10 80,562,942 (GRCm39) missense probably damaging 1.00
R1940:Ap3d1 UTSW 10 80,545,607 (GRCm39) missense probably benign 0.03
R2081:Ap3d1 UTSW 10 80,568,770 (GRCm39) missense probably damaging 1.00
R2258:Ap3d1 UTSW 10 80,556,966 (GRCm39) missense probably benign 0.03
R2281:Ap3d1 UTSW 10 80,549,832 (GRCm39) missense probably damaging 0.96
R2398:Ap3d1 UTSW 10 80,555,006 (GRCm39) nonsense probably null
R2849:Ap3d1 UTSW 10 80,577,742 (GRCm39) missense possibly damaging 0.65
R4350:Ap3d1 UTSW 10 80,555,119 (GRCm39) missense probably benign 0.15
R4590:Ap3d1 UTSW 10 80,555,646 (GRCm39) nonsense probably null
R4782:Ap3d1 UTSW 10 80,557,420 (GRCm39) splice site probably null
R4785:Ap3d1 UTSW 10 80,548,612 (GRCm39) frame shift probably null
R4834:Ap3d1 UTSW 10 80,555,560 (GRCm39) missense probably damaging 1.00
R4864:Ap3d1 UTSW 10 80,548,612 (GRCm39) frame shift probably null
R5051:Ap3d1 UTSW 10 80,555,033 (GRCm39) missense probably damaging 1.00
R5109:Ap3d1 UTSW 10 80,545,284 (GRCm39) missense probably benign 0.11
R5219:Ap3d1 UTSW 10 80,545,651 (GRCm39) missense probably benign 0.03
R5220:Ap3d1 UTSW 10 80,563,001 (GRCm39) missense probably damaging 1.00
R5307:Ap3d1 UTSW 10 80,559,383 (GRCm39) missense probably benign 0.29
R5586:Ap3d1 UTSW 10 80,554,964 (GRCm39) missense possibly damaging 0.92
R5796:Ap3d1 UTSW 10 80,549,871 (GRCm39) missense possibly damaging 0.70
R5905:Ap3d1 UTSW 10 80,558,761 (GRCm39) missense possibly damaging 0.50
R6025:Ap3d1 UTSW 10 80,546,298 (GRCm39) missense probably benign 0.01
R6028:Ap3d1 UTSW 10 80,558,761 (GRCm39) missense possibly damaging 0.50
R6364:Ap3d1 UTSW 10 80,546,328 (GRCm39) splice site probably null
R6469:Ap3d1 UTSW 10 80,547,992 (GRCm39) missense probably benign
R6603:Ap3d1 UTSW 10 80,549,881 (GRCm39) missense probably benign 0.04
R6872:Ap3d1 UTSW 10 80,550,156 (GRCm39) nonsense probably null
R6887:Ap3d1 UTSW 10 80,559,532 (GRCm39) missense probably damaging 1.00
R7249:Ap3d1 UTSW 10 80,577,767 (GRCm39) missense probably damaging 1.00
R7316:Ap3d1 UTSW 10 80,553,693 (GRCm39) missense probably damaging 1.00
R7325:Ap3d1 UTSW 10 80,559,637 (GRCm39) missense probably damaging 1.00
R7395:Ap3d1 UTSW 10 80,566,716 (GRCm39) missense probably benign 0.11
R7405:Ap3d1 UTSW 10 80,577,734 (GRCm39) missense probably benign 0.16
R7425:Ap3d1 UTSW 10 80,557,426 (GRCm39) missense probably damaging 1.00
R7558:Ap3d1 UTSW 10 80,558,755 (GRCm39) missense possibly damaging 0.92
R7583:Ap3d1 UTSW 10 80,545,292 (GRCm39) missense probably benign 0.13
R7703:Ap3d1 UTSW 10 80,553,678 (GRCm39) missense probably damaging 1.00
R7964:Ap3d1 UTSW 10 80,565,891 (GRCm39) missense probably damaging 1.00
R8021:Ap3d1 UTSW 10 80,550,135 (GRCm39) missense probably benign 0.30
R8200:Ap3d1 UTSW 10 80,558,766 (GRCm39) nonsense probably null
R8314:Ap3d1 UTSW 10 80,559,373 (GRCm39) missense possibly damaging 0.91
R8356:Ap3d1 UTSW 10 80,568,737 (GRCm39) missense probably damaging 1.00
R8896:Ap3d1 UTSW 10 80,552,425 (GRCm39) missense probably benign 0.01
R8936:Ap3d1 UTSW 10 80,547,952 (GRCm39) missense probably benign 0.02
R9183:Ap3d1 UTSW 10 80,545,627 (GRCm39) missense probably null 0.06
R9209:Ap3d1 UTSW 10 80,554,918 (GRCm39) missense probably benign 0.04
R9259:Ap3d1 UTSW 10 80,559,661 (GRCm39) missense probably damaging 1.00
R9476:Ap3d1 UTSW 10 80,545,655 (GRCm39) missense probably benign 0.00
R9645:Ap3d1 UTSW 10 80,545,062 (GRCm39) missense probably benign
R9664:Ap3d1 UTSW 10 80,548,639 (GRCm39) missense possibly damaging 0.71
R9781:Ap3d1 UTSW 10 80,545,609 (GRCm39) missense possibly damaging 0.51
X0019:Ap3d1 UTSW 10 80,554,936 (GRCm39) missense probably damaging 1.00
X0026:Ap3d1 UTSW 10 80,556,981 (GRCm39) missense possibly damaging 0.46
Z1088:Ap3d1 UTSW 10 80,555,071 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CAGCTACCTCTTGAGGACAC -3'
(R):5'- TAGCCAGCAGGACGTTTGTC -3'

Sequencing Primer
(F):5'- TTGAGGACACCACTACTGTGATC -3'
(R):5'- GACGTTTGTCCCCAAGGCATC -3'
Posted On 2015-04-06