Incidental Mutation 'R3856:Ppp1r12a'
ID276170
Institutional Source Beutler Lab
Gene Symbol Ppp1r12a
Ensembl Gene ENSMUSG00000019907
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 12A
Synonyms1200015F06Rik, 5730577I22Rik, Mypt1, D10Ertd625e
MMRRC Submission 040902-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3856 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location108162193-108284475 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 108253501 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070663] [ENSMUST00000219263] [ENSMUST00000219759]
Predicted Effect probably benign
Transcript: ENSMUST00000070663
SMART Domains Protein: ENSMUSP00000069257
Gene: ENSMUSG00000019907

DomainStartEndE-ValueType
ANK 38 68 1.01e2 SMART
ANK 72 101 1.66e-6 SMART
ANK 105 134 6.36e-3 SMART
ANK 138 168 5.52e2 SMART
ANK 198 227 6.12e-5 SMART
ANK 231 260 5.16e-3 SMART
coiled coil region 333 354 N/A INTRINSIC
low complexity region 385 402 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
low complexity region 517 531 N/A INTRINSIC
low complexity region 564 578 N/A INTRINSIC
low complexity region 596 610 N/A INTRINSIC
low complexity region 626 656 N/A INTRINSIC
PDB:2KJY|A 657 712 5e-12 PDB
low complexity region 719 745 N/A INTRINSIC
low complexity region 771 794 N/A INTRINSIC
low complexity region 815 833 N/A INTRINSIC
low complexity region 836 851 N/A INTRINSIC
low complexity region 883 902 N/A INTRINSIC
Pfam:PRKG1_interact 930 993 4.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219068
Predicted Effect probably benign
Transcript: ENSMUST00000219263
Predicted Effect probably benign
Transcript: ENSMUST00000219759
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin phosphatase target subunit 1, which is also called the myosin-binding subunit of myosin phosphatase, is one of the subunits of myosin phosphatase. Myosin phosphatase regulates the interaction of actin and myosin downstream of the guanosine triphosphatase Rho. The small guanosine triphosphatase Rho is implicated in myosin light chain (MLC) phosphorylation, which results in contraction of smooth muscle and interaction of actin and myosin in nonmuscle cells. The guanosine triphosphate (GTP)-bound, active form of RhoA (GTP.RhoA) specifically interacted with the myosin-binding subunit (MBS) of myosin phosphatase, which regulates the extent of phosphorylation of MLC. Rho-associated kinase (Rho-kinase), which is activated by GTP. RhoA, phosphorylated MBS and consequently inactivated myosin phosphatase. Overexpression of RhoA or activated RhoA in NIH 3T3 cells increased phosphorylation of MBS and MLC. Thus, Rho appears to inhibit myosin phosphatase through the action of Rho-kinase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous null mice die before E7.5. Mice homozygous for a floxed allele activated in smooth muscle exhibit altered intestinal smooth muscle contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T C 14: 103,055,446 S469P possibly damaging Het
Adgrf5 A T 17: 43,447,036 N787I possibly damaging Het
Ank2 T C 3: 126,929,844 T945A probably benign Het
Aox4 T A 1: 58,253,934 I863N probably damaging Het
Ap3d1 A G 10: 80,712,185 I891T probably benign Het
Apex1 A G 14: 50,926,257 T109A probably benign Het
Arhgef1 G A 7: 24,919,272 G107S probably damaging Het
Atxn7l1 A G 12: 33,367,600 T587A probably damaging Het
Atxn7l3 T C 11: 102,293,903 D128G probably damaging Het
Cacna1h T C 17: 25,392,453 Y457C probably damaging Het
Ccdc60 A C 5: 116,172,455 C183G probably damaging Het
Cep131 G A 11: 120,067,185 R772* probably null Het
Cnst C T 1: 179,579,714 P109S probably benign Het
Crtc2 G T 3: 90,262,570 L509F probably damaging Het
Ctsr A T 13: 61,161,936 I153N possibly damaging Het
Dffa A T 4: 149,104,251 M1L possibly damaging Het
Dnajc16 G A 4: 141,763,653 R729* probably null Het
Eef2k T A 7: 120,899,371 C91* probably null Het
Eml5 T C 12: 98,816,024 D1336G probably damaging Het
F12 G A 13: 55,421,222 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fbxo40 A T 16: 36,969,083 L555Q probably damaging Het
Frmpd1 T C 4: 45,283,698 S840P probably damaging Het
Gadd45a C T 6: 67,037,005 probably null Het
Galnt7 T C 8: 57,532,624 probably benign Het
Gm5592 G A 7: 41,157,835 probably benign Het
Gpr171 T C 3: 59,098,085 T90A probably damaging Het
Gpr82 A T X: 13,665,338 T42S probably benign Het
H2-M10.6 T A 17: 36,812,504 I30N probably benign Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Hspa4l C A 3: 40,785,389 H698Q probably benign Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Kdm4a C T 4: 118,153,231 R605H probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Olfr608 T A 7: 103,470,660 V207E probably damaging Het
Pbp2 A G 6: 135,310,145 L68P probably benign Het
Pcnx3 G T 19: 5,678,967 T547K probably benign Het
Prmt9 G A 8: 77,568,265 V413I probably benign Het
Pudp T C 18: 50,568,053 N203S probably benign Het
Rnf213 T C 11: 119,480,939 probably benign Het
Sall3 G A 18: 80,972,502 T737M probably damaging Het
Scn2b A G 9: 45,125,461 N89S possibly damaging Het
Sgsm1 A G 5: 113,263,259 V580A probably benign Het
Slc13a4 C A 6: 35,271,604 probably null Het
Slc4a4 A C 5: 89,232,839 S1015R probably benign Het
Slc8a1 T C 17: 81,648,374 T412A probably benign Het
Spag17 A T 3: 100,106,759 D2116V probably damaging Het
Trim55 T C 3: 19,672,956 F396L probably benign Het
Usp54 C A 14: 20,588,420 M197I probably damaging Het
Vmn1r189 A T 13: 22,102,269 F133I possibly damaging Het
Zfp735 T C 11: 73,711,456 S409P probably benign Het
Other mutations in Ppp1r12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Ppp1r12a APN 10 108198848 missense probably damaging 1.00
IGL00727:Ppp1r12a APN 10 108230473 missense probably damaging 1.00
IGL00819:Ppp1r12a APN 10 108240821 missense probably damaging 0.98
IGL01538:Ppp1r12a APN 10 108234021 missense probably damaging 1.00
IGL02227:Ppp1r12a APN 10 108269324 missense probably damaging 1.00
IGL02957:Ppp1r12a APN 10 108198918 missense probably damaging 0.98
IGL03063:Ppp1r12a APN 10 108261254 missense probably damaging 1.00
IGL03260:Ppp1r12a APN 10 108261245 missense probably benign 0.10
R0049:Ppp1r12a UTSW 10 108253332 missense possibly damaging 0.63
R0268:Ppp1r12a UTSW 10 108273381 intron probably benign
R0826:Ppp1r12a UTSW 10 108230553 missense possibly damaging 0.46
R0839:Ppp1r12a UTSW 10 108198861 missense probably damaging 1.00
R1026:Ppp1r12a UTSW 10 108251859 missense probably benign 0.08
R1053:Ppp1r12a UTSW 10 108262351 missense probably damaging 1.00
R1376:Ppp1r12a UTSW 10 108198918 missense probably damaging 0.98
R1376:Ppp1r12a UTSW 10 108198918 missense probably damaging 0.98
R1511:Ppp1r12a UTSW 10 108251859 missense probably benign 0.08
R1616:Ppp1r12a UTSW 10 108260867 missense probably damaging 1.00
R1673:Ppp1r12a UTSW 10 108249565 missense probably damaging 0.96
R1866:Ppp1r12a UTSW 10 108262431 missense possibly damaging 0.85
R1901:Ppp1r12a UTSW 10 108198891 missense probably damaging 1.00
R1902:Ppp1r12a UTSW 10 108198891 missense probably damaging 1.00
R2233:Ppp1r12a UTSW 10 108198919 missense possibly damaging 0.83
R2234:Ppp1r12a UTSW 10 108198919 missense possibly damaging 0.83
R3760:Ppp1r12a UTSW 10 108264734 missense probably damaging 1.00
R3973:Ppp1r12a UTSW 10 108253480 missense probably benign 0.44
R3974:Ppp1r12a UTSW 10 108253480 missense probably benign 0.44
R3976:Ppp1r12a UTSW 10 108253480 missense probably benign 0.44
R4502:Ppp1r12a UTSW 10 108249478 missense probably benign 0.26
R4902:Ppp1r12a UTSW 10 108230590 missense probably damaging 1.00
R5092:Ppp1r12a UTSW 10 108267402 critical splice acceptor site probably null
R5224:Ppp1r12a UTSW 10 108261025 missense probably benign 0.37
R5353:Ppp1r12a UTSW 10 108261216 intron probably null
R5428:Ppp1r12a UTSW 10 108253347 missense possibly damaging 0.76
R5472:Ppp1r12a UTSW 10 108240112 missense probably damaging 1.00
R5510:Ppp1r12a UTSW 10 108249627 missense possibly damaging 0.82
R6217:Ppp1r12a UTSW 10 108240184 splice site probably null
R6274:Ppp1r12a UTSW 10 108260890 missense probably benign 0.00
R6431:Ppp1r12a UTSW 10 108262420 missense probably damaging 1.00
R6744:Ppp1r12a UTSW 10 108230534 missense probably damaging 1.00
R6838:Ppp1r12a UTSW 10 108261276 missense possibly damaging 0.76
R6865:Ppp1r12a UTSW 10 108262381 nonsense probably null
R6993:Ppp1r12a UTSW 10 108240837 missense probably benign 0.18
R7565:Ppp1r12a UTSW 10 108268640 missense probably benign 0.21
X0027:Ppp1r12a UTSW 10 108214423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAATCGTTTGTGGGCTGAGG -3'
(R):5'- CTAGGCTGGAGTCAATACATGA -3'

Sequencing Primer
(F):5'- AATCGTTTGTGGGCTGAGGATAGTAC -3'
(R):5'- CCTCTGGAAGGGCATCTTAACTG -3'
Posted On2015-04-06