Mutagenetix > Incidental Mutation

Incidental Mutation 'R3856:Eml5'

276176

Institutional Source

Beutler Lab

Gene Symbol

Eml5

Ensembl Gene

ENSMUSG00000051166

Gene Name

echinoderm microtubule associated protein like 5

Synonyms

C130068M19Rik

MMRRC Submission

040902-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.237) question?

Stock #

R3856 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98786805-98901484 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 98816024 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1336 (D1336G)

Ref Sequence

ENSEMBL: ENSMUSP00000065643 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]

AlphaFold

Q8BQM8

Predicted Effect

probably damaging
Transcript: ENSMUST00000065716
AA Change: D1336G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: D1336G

Domain	Start	End	E-Value	Type
Pfam:HELP	1	49	3.3e-21	PFAM
WD40	50	91	6.42e-1	SMART
WD40	94	136	1.08e-4	SMART
WD40	139	178	1.27e-1	SMART
WD40	184	224	2.75e1	SMART
WD40	225	263	2.65e-4	SMART
Blast:WD40	265	312	2e-22	BLAST
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.2e2	SMART
WD40	397	436	8.59e-1	SMART
WD40	444	479	6.6e1	SMART
WD40	505	546	2.74e2	SMART
WD40	552	592	4.8e-2	SMART
low complexity region	609	632	N/A	INTRINSIC
Pfam:HELP	656	715	1.4e-20	PFAM
WD40	716	757	1.18e-1	SMART
WD40	760	802	2.84e-4	SMART
WD40	805	844	1.91e1	SMART
WD40	853	891	2.64e2	SMART
WD40	892	929	3.45e-3	SMART
WD40	985	1026	4.55e-3	SMART
WD40	1029	1068	6.39e0	SMART
WD40	1071	1111	5.15e-2	SMART
WD40	1180	1221	1.9e2	SMART
WD40	1227	1267	1.38e0	SMART
low complexity region	1280	1297	N/A	INTRINSIC
Pfam:HELP	1335	1410	2.4e-16	PFAM
Blast:WD40	1412	1462	8e-28	BLAST
WD40	1465	1507	1.56e-1	SMART
WD40	1510	1549	2.06e0	SMART
WD40	1558	1597	8.22e1	SMART
WD40	1599	1644	4.26e1	SMART
WD40	1690	1730	2.19e-5	SMART
WD40	1774	1813	5.97e-1	SMART
WD40	1884	1925	2.39e0	SMART
WD40	1931	1971	2.88e-1	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000222128
AA Change: D165G

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222872

Predicted Effect

probably damaging
Transcript: ENSMUST00000223282
AA Change: D1383G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.9282

Coding Region Coverage

1x: 99.6%
3x: 98.7%
10x: 96.7%
20x: 92.4%

Validation Efficiency

100% (57/57)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acod1	T	C	14: 103,055,446	S469P	possibly damaging	Het
Adgrf5	A	T	17: 43,447,036	N787I	possibly damaging	Het
Ank2	T	C	3: 126,929,844	T945A	probably benign	Het
Aox4	T	A	1: 58,253,934	I863N	probably damaging	Het
Ap3d1	A	G	10: 80,712,185	I891T	probably benign	Het
Apex1	A	G	14: 50,926,257	T109A	probably benign	Het
Arhgef1	G	A	7: 24,919,272	G107S	probably damaging	Het
Atxn7l1	A	G	12: 33,367,600	T587A	probably damaging	Het
Atxn7l3	T	C	11: 102,293,903	D128G	probably damaging	Het
Cacna1h	T	C	17: 25,392,453	Y457C	probably damaging	Het
Ccdc60	A	C	5: 116,172,455	C183G	probably damaging	Het
Cep131	G	A	11: 120,067,185	R772*	probably null	Het
Cnst	C	T	1: 179,579,714	P109S	probably benign	Het
Crtc2	G	T	3: 90,262,570	L509F	probably damaging	Het
Ctsr	A	T	13: 61,161,936	I153N	possibly damaging	Het
Dffa	A	T	4: 149,104,251	M1L	possibly damaging	Het
Dnajc16	G	A	4: 141,763,653	R729*	probably null	Het
Eef2k	T	A	7: 120,899,371	C91*	probably null	Het
F12	G	A	13: 55,421,222		probably null	Het
Fam43b	G	C	4: 138,395,098	R304G	probably benign	Het
Fbxo40	A	T	16: 36,969,083	L555Q	probably damaging	Het
Frmpd1	T	C	4: 45,283,698	S840P	probably damaging	Het
Gadd45a	C	T	6: 67,037,005		probably null	Het
Galnt7	T	C	8: 57,532,624		probably benign	Het
Gm5592	G	A	7: 41,157,835		probably benign	Het
Gpr171	T	C	3: 59,098,085	T90A	probably damaging	Het
Gpr82	A	T	X: 13,665,338	T42S	probably benign	Het
H2-M10.6	T	A	17: 36,812,504	I30N	probably benign	Het
Hk2	T	C	6: 82,736,676	E447G	possibly damaging	Het
Hspa4l	C	A	3: 40,785,389	H698Q	probably benign	Het
Idi1	G	T	13: 8,885,932	A25S	probably benign	Het
Kdm4a	C	T	4: 118,153,231	R605H	probably damaging	Het
Nhlrc2	T	C	19: 56,588,271		probably null	Het
Nt5c2	A	G	19: 46,896,518	V252A	probably damaging	Het
Olfr608	T	A	7: 103,470,660	V207E	probably damaging	Het
Pbp2	A	G	6: 135,310,145	L68P	probably benign	Het
Pcnx3	G	T	19: 5,678,967	T547K	probably benign	Het
Ppp1r12a	T	C	10: 108,253,501		probably benign	Het
Prmt9	G	A	8: 77,568,265	V413I	probably benign	Het
Pudp	T	C	18: 50,568,053	N203S	probably benign	Het
Rnf213	T	C	11: 119,480,939		probably benign	Het
Sall3	G	A	18: 80,972,502	T737M	probably damaging	Het
Scn2b	A	G	9: 45,125,461	N89S	possibly damaging	Het
Sgsm1	A	G	5: 113,263,259	V580A	probably benign	Het
Slc13a4	C	A	6: 35,271,604		probably null	Het
Slc4a4	A	C	5: 89,232,839	S1015R	probably benign	Het
Slc8a1	T	C	17: 81,648,374	T412A	probably benign	Het
Spag17	A	T	3: 100,106,759	D2116V	probably damaging	Het
Trim55	T	C	3: 19,672,956	F396L	probably benign	Het
Usp54	C	A	14: 20,588,420	M197I	probably damaging	Het
Vmn1r189	A	T	13: 22,102,269	F133I	possibly damaging	Het
Zfp735	T	C	11: 73,711,456	S409P	probably benign	Het

Other mutations in Eml5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Eml5	APN	12	98873209	splice site	probably benign
IGL00473:Eml5	APN	12	98805492	splice site	probably benign
IGL01120:Eml5	APN	12	98844019	missense	probably benign
IGL01308:Eml5	APN	12	98802313	missense	probably damaging	1.00
IGL01790:Eml5	APN	12	98798932	missense	probably damaging	1.00
IGL01973:Eml5	APN	12	98863280	missense	probably benign
IGL02182:Eml5	APN	12	98802322	missense	probably damaging	1.00
IGL02201:Eml5	APN	12	98794424	splice site	probably benign
IGL02375:Eml5	APN	12	98844087	missense	probably damaging	1.00
IGL02397:Eml5	APN	12	98790674	missense	probably benign	0.07
IGL02480:Eml5	APN	12	98876243	missense	probably damaging	1.00
IGL02801:Eml5	APN	12	98817845	missense	possibly damaging	0.88
IGL02876:Eml5	APN	12	98858841	missense	probably damaging	1.00
IGL03104:Eml5	APN	12	98861245	nonsense	probably null
IGL03158:Eml5	APN	12	98827514	splice site	probably benign
IGL03286:Eml5	APN	12	98860503	missense	probably damaging	1.00
IGL03380:Eml5	APN	12	98874647	splice site	probably benign
BB010:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
BB020:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R0573:Eml5	UTSW	12	98824772	splice site	probably null
R0624:Eml5	UTSW	12	98865479	missense	probably damaging	1.00
R0993:Eml5	UTSW	12	98861183	missense	probably benign	0.25
R1073:Eml5	UTSW	12	98830973	missense	probably damaging	1.00
R1183:Eml5	UTSW	12	98792046	missense	probably benign	0.31
R1352:Eml5	UTSW	12	98831003	splice site	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1503:Eml5	UTSW	12	98831174	missense	probably damaging	0.99
R1538:Eml5	UTSW	12	98794276	missense	probably damaging	0.99
R1689:Eml5	UTSW	12	98830935	missense	probably damaging	1.00
R1773:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1775:Eml5	UTSW	12	98852704	splice site	probably null
R1791:Eml5	UTSW	12	98887056	missense	probably benign	0.31
R1856:Eml5	UTSW	12	98810584	missense	probably damaging	1.00
R1919:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1957:Eml5	UTSW	12	98859961	missense	probably damaging	1.00
R1962:Eml5	UTSW	12	98876311	missense	probably damaging	0.99
R2033:Eml5	UTSW	12	98791386	missense	possibly damaging	0.71
R2035:Eml5	UTSW	12	98794266	missense	probably benign	0.33
R2073:Eml5	UTSW	12	98802446	missense	probably damaging	0.99
R2143:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2144:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2158:Eml5	UTSW	12	98843946	splice site	probably benign
R2164:Eml5	UTSW	12	98887097	missense	probably damaging	0.99
R2175:Eml5	UTSW	12	98876223	nonsense	probably null
R2200:Eml5	UTSW	12	98825417	missense	probably damaging	1.00
R2234:Eml5	UTSW	12	98841581	missense	probably damaging	1.00
R2504:Eml5	UTSW	12	98844105	missense	possibly damaging	0.71
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2958:Eml5	UTSW	12	98876178	missense	possibly damaging	0.74
R3013:Eml5	UTSW	12	98880808	splice site	probably null
R3118:Eml5	UTSW	12	98865494	missense	probably damaging	0.97
R3735:Eml5	UTSW	12	98855989	missense	possibly damaging	0.78
R3900:Eml5	UTSW	12	98825523	missense	probably damaging	1.00
R3973:Eml5	UTSW	12	98802465	splice site	probably benign
R3976:Eml5	UTSW	12	98802465	splice site	probably benign
R4105:Eml5	UTSW	12	98841548	splice site	probably null
R4107:Eml5	UTSW	12	98841548	splice site	probably null
R4108:Eml5	UTSW	12	98841548	splice site	probably null
R4109:Eml5	UTSW	12	98841548	splice site	probably null
R4258:Eml5	UTSW	12	98865434	missense	probably benign	0.01
R4381:Eml5	UTSW	12	98815955	missense	possibly damaging	0.93
R4590:Eml5	UTSW	12	98837341	missense	possibly damaging	0.91
R4737:Eml5	UTSW	12	98798852	missense	probably damaging	1.00
R4775:Eml5	UTSW	12	98802307	missense	probably benign	0.05
R4850:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5007:Eml5	UTSW	12	98830965	missense	probably damaging	1.00
R5092:Eml5	UTSW	12	98792616	missense	probably damaging	1.00
R5123:Eml5	UTSW	12	98874512	missense	probably damaging	1.00
R5124:Eml5	UTSW	12	98792042	missense	probably damaging	1.00
R5273:Eml5	UTSW	12	98790688	missense	probably damaging	1.00
R5369:Eml5	UTSW	12	98858783	missense	probably damaging	1.00
R5430:Eml5	UTSW	12	98794158	missense	probably damaging	1.00
R5748:Eml5	UTSW	12	98825555	missense	probably damaging	0.99
R5769:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5832:Eml5	UTSW	12	98876188	missense	probably benign
R6113:Eml5	UTSW	12	98824674	nonsense	probably null
R6131:Eml5	UTSW	12	98861251	missense	probably damaging	0.99
R6175:Eml5	UTSW	12	98794456	missense	possibly damaging	0.69
R6184:Eml5	UTSW	12	98863129	missense	possibly damaging	0.53
R6357:Eml5	UTSW	12	98870884	missense	probably damaging	0.98
R6375:Eml5	UTSW	12	98798868
R6528:Eml5	UTSW	12	98824637	missense	probably benign	0.18
R6657:Eml5	UTSW	12	98791405	missense	probably damaging	0.98
R6717:Eml5	UTSW	12	98827506	missense	probably damaging	1.00
R6751:Eml5	UTSW	12	98865400	missense	probably damaging	1.00
R6833:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6834:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6972:Eml5	UTSW	12	98876180	missense	probably benign	0.00
R7091:Eml5	UTSW	12	98802474	missense	probably benign	0.16
R7353:Eml5	UTSW	12	98825424	missense
R7644:Eml5	UTSW	12	98855944	missense	probably benign	0.05
R7694:Eml5	UTSW	12	98792563	missense	probably damaging	0.99
R7842:Eml5	UTSW	12	98794135	missense	probably damaging	1.00
R7933:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R8111:Eml5	UTSW	12	98792514	critical splice donor site	probably null
R8198:Eml5	UTSW	12	98858886	nonsense	probably null
R8482:Eml5	UTSW	12	98876301	missense	probably damaging	1.00
R8732:Eml5	UTSW	12	98815959	missense	probably damaging	0.99
R8956:Eml5	UTSW	12	98852693	missense	possibly damaging	0.69
R8975:Eml5	UTSW	12	98810570	missense	probably damaging	0.99
R9131:Eml5	UTSW	12	98858840	missense	probably damaging	1.00
R9258:Eml5	UTSW	12	98844117	missense	possibly damaging	0.77
R9261:Eml5	UTSW	12	98856028	missense	probably damaging	0.99
R9276:Eml5	UTSW	12	98798801	missense	probably damaging	0.99
R9301:Eml5	UTSW	12	98882033	nonsense	probably null
R9368:Eml5	UTSW	12	98796578	missense	probably benign	0.31
R9392:Eml5	UTSW	12	98900940	missense	probably damaging	1.00
R9393:Eml5	UTSW	12	98876174	missense	probably benign	0.35
R9449:Eml5	UTSW	12	98861295	missense	probably damaging	1.00
R9570:Eml5	UTSW	12	98815984	missense	probably benign	0.15
T0722:Eml5	UTSW	12	98841582	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGACCCTGTCTTGAAAACAAAC -3'
(R):5'- ACTTTTGGGGAAGAAGAGGTTC -3'

Sequencing Primer
(F):5'- GACCCTGTCTTGAAAACAAACCAAAC -3'
(R):5'- TTTGGGGAAGAAGAGGTTCAGTGG -3'

Posted On

2015-04-06