Incidental Mutation 'R3856:F12'
List |< first << previous [record 20 of 53] next >> last >|
ID276179
Institutional Source Beutler Lab
Gene Symbol F12
Ensembl Gene ENSMUSG00000021492
Gene Namecoagulation factor XII (Hageman factor)
SynonymsFXII
MMRRC Submission 040902-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R3856 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55417958-55426793 bp(-) (GRCm38)
Type of Mutationintron (21 bp from exon)
DNA Base Change (assembly) G to A at 55421222 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021948] [ENSMUST00000170921]
Predicted Effect probably null
Transcript: ENSMUST00000021948
SMART Domains Protein: ENSMUSP00000021948
Gene: ENSMUSG00000021492

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
FN2 40 88 4.3e-24 SMART
EGF 97 131 4.22e-4 SMART
FN1 135 175 2.4e-13 SMART
EGF 177 210 3.94e-4 SMART
KR 215 297 6.88e-27 SMART
low complexity region 302 320 N/A INTRINSIC
Tryp_SPc 354 591 7.74e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170921
SMART Domains Protein: ENSMUSP00000125771
Gene: ENSMUSG00000021492

DomainStartEndE-ValueType
Tryp_SPc 2 137 3.4e-7 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: This gene encodes a glycoprotein coagulation factor that plays an important role in the intrinsic pathway of blood coagulation and hemostasis. The encoded protein is an inactive zymogen that is autoactivated upon contact with negatively charged surfaces or misfolded protein aggregates. Mice lacking the encoded protein have a severe defect in forming stable fibrin clots. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele are protected from ischemic brain injury in an experimental stroke model, without exhibiting an increase in infarct-associated hemorrhage. Another null mouse shows decreased plasma bradykinin levels and prolonged activated partial thromboplastin times. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T C 14: 103,055,446 S469P possibly damaging Het
Adgrf5 A T 17: 43,447,036 N787I possibly damaging Het
Ank2 T C 3: 126,929,844 T945A probably benign Het
Aox4 T A 1: 58,253,934 I863N probably damaging Het
Ap3d1 A G 10: 80,712,185 I891T probably benign Het
Apex1 A G 14: 50,926,257 T109A probably benign Het
Arhgef1 G A 7: 24,919,272 G107S probably damaging Het
Atxn7l1 A G 12: 33,367,600 T587A probably damaging Het
Atxn7l3 T C 11: 102,293,903 D128G probably damaging Het
Cacna1h T C 17: 25,392,453 Y457C probably damaging Het
Ccdc60 A C 5: 116,172,455 C183G probably damaging Het
Cep131 G A 11: 120,067,185 R772* probably null Het
Cnst C T 1: 179,579,714 P109S probably benign Het
Crtc2 G T 3: 90,262,570 L509F probably damaging Het
Ctsr A T 13: 61,161,936 I153N possibly damaging Het
Dffa A T 4: 149,104,251 M1L possibly damaging Het
Dnajc16 G A 4: 141,763,653 R729* probably null Het
Eef2k T A 7: 120,899,371 C91* probably null Het
Eml5 T C 12: 98,816,024 D1336G probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fbxo40 A T 16: 36,969,083 L555Q probably damaging Het
Frmpd1 T C 4: 45,283,698 S840P probably damaging Het
Gadd45a C T 6: 67,037,005 probably null Het
Galnt7 T C 8: 57,532,624 probably benign Het
Gm5592 G A 7: 41,157,835 probably benign Het
Gpr171 T C 3: 59,098,085 T90A probably damaging Het
Gpr82 A T X: 13,665,338 T42S probably benign Het
H2-M10.6 T A 17: 36,812,504 I30N probably benign Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Hspa4l C A 3: 40,785,389 H698Q probably benign Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Kdm4a C T 4: 118,153,231 R605H probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Olfr608 T A 7: 103,470,660 V207E probably damaging Het
Pbp2 A G 6: 135,310,145 L68P probably benign Het
Pcnx3 G T 19: 5,678,967 T547K probably benign Het
Ppp1r12a T C 10: 108,253,501 probably benign Het
Prmt9 G A 8: 77,568,265 V413I probably benign Het
Pudp T C 18: 50,568,053 N203S probably benign Het
Rnf213 T C 11: 119,480,939 probably benign Het
Sall3 G A 18: 80,972,502 T737M probably damaging Het
Scn2b A G 9: 45,125,461 N89S possibly damaging Het
Sgsm1 A G 5: 113,263,259 V580A probably benign Het
Slc13a4 C A 6: 35,271,604 probably null Het
Slc4a4 A C 5: 89,232,839 S1015R probably benign Het
Slc8a1 T C 17: 81,648,374 T412A probably benign Het
Spag17 A T 3: 100,106,759 D2116V probably damaging Het
Trim55 T C 3: 19,672,956 F396L probably benign Het
Usp54 C A 14: 20,588,420 M197I probably damaging Het
Vmn1r189 A T 13: 22,102,269 F133I possibly damaging Het
Zfp735 T C 11: 73,711,456 S409P probably benign Het
Other mutations in F12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02535:F12 APN 13 55426344 missense possibly damaging 0.83
IGL02756:F12 APN 13 55421067 missense possibly damaging 0.58
IGL03030:F12 APN 13 55421519 intron probably benign
R0049:F12 UTSW 13 55426317 missense probably benign 0.00
R0049:F12 UTSW 13 55426317 missense probably benign 0.00
R0646:F12 UTSW 13 55422483 intron probably benign
R1670:F12 UTSW 13 55421533 missense probably damaging 1.00
R1896:F12 UTSW 13 55420727 missense probably damaging 1.00
R3508:F12 UTSW 13 55421059 missense probably benign
R3548:F12 UTSW 13 55418137 missense probably benign 0.03
R4583:F12 UTSW 13 55421130 missense probably benign 0.04
R5177:F12 UTSW 13 55420168 missense probably benign 0.08
R5369:F12 UTSW 13 55418491 missense probably benign 0.13
R5529:F12 UTSW 13 55422059 missense probably benign 0.04
R5637:F12 UTSW 13 55422415 missense possibly damaging 0.57
R6812:F12 UTSW 13 55421845 missense probably damaging 0.97
R7156:F12 UTSW 13 55418497 missense probably damaging 1.00
R8007:F12 UTSW 13 55418452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAGGTGCAAACGTTGGCG -3'
(R):5'- AGAGGGCTCCAACAGACTCATC -3'

Sequencing Primer
(F):5'- GCGTCTGGCACTGCTCC -3'
(R):5'- CTCTAGACCTTTGGGCGAC -3'
Posted On2015-04-06