Mutagenetix > Incidental Mutations

Incidental Mutation 'R3856:Usp54'

276181

Institutional Source

Beutler Lab

Gene Symbol

Usp54

Ensembl Gene

ENSMUSG00000034235

Gene Name

ubiquitin specific peptidase 54

Synonyms

C030002J06Rik, 4930429G18Rik

MMRRC Submission

040902-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3856 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20548912-20641063 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 20588420 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 197 (M197I)

Ref Sequence

ENSEMBL: ENSMUSP00000036214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022356] [ENSMUST00000035340]

AlphaFold

Q8BL06

Predicted Effect

probably damaging
Transcript: ENSMUST00000022356
AA Change: M197I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022356
Gene: ENSMUSG00000034235
AA Change: M197I

Domain	Start	End	E-Value	Type
Pfam:UCH	30	349	2.4e-23	PFAM
Pfam:UCH_1	31	324	2.1e-7	PFAM
low complexity region	403	412	N/A	INTRINSIC
low complexity region	439	445	N/A	INTRINSIC
low complexity region	498	513	N/A	INTRINSIC
low complexity region	601	616	N/A	INTRINSIC
coiled coil region	682	712	N/A	INTRINSIC
low complexity region	808	826	N/A	INTRINSIC
low complexity region	881	894	N/A	INTRINSIC
low complexity region	1002	1020	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000035340
AA Change: M197I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000036214
Gene: ENSMUSG00000034235
AA Change: M197I

Domain	Start	End	E-Value	Type
Pfam:UCH	31	349	2.3e-21	PFAM
low complexity region	403	412	N/A	INTRINSIC
low complexity region	439	445	N/A	INTRINSIC
low complexity region	498	513	N/A	INTRINSIC
low complexity region	601	616	N/A	INTRINSIC
coiled coil region	682	712	N/A	INTRINSIC
low complexity region	808	826	N/A	INTRINSIC
low complexity region	881	894	N/A	INTRINSIC
low complexity region	1002	1020	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123287

SMART Domains

Protein: ENSMUSP00000117503
Gene: ENSMUSG00000034235

Domain	Start	End	E-Value	Type
low complexity region	82	95	N/A	INTRINSIC
low complexity region	156	165	N/A	INTRINSIC
low complexity region	192	198	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127342

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143267

Meta Mutation Damage Score

0.2246

Coding Region Coverage

1x: 99.6%
3x: 98.7%
10x: 96.7%
20x: 92.4%

Validation Efficiency

100% (57/57)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acod1	T	C	14: 103,055,446	S469P	possibly damaging	Het
Adgrf5	A	T	17: 43,447,036	N787I	possibly damaging	Het
Ank2	T	C	3: 126,929,844	T945A	probably benign	Het
Aox4	T	A	1: 58,253,934	I863N	probably damaging	Het
Ap3d1	A	G	10: 80,712,185	I891T	probably benign	Het
Apex1	A	G	14: 50,926,257	T109A	probably benign	Het
Arhgef1	G	A	7: 24,919,272	G107S	probably damaging	Het
Atxn7l1	A	G	12: 33,367,600	T587A	probably damaging	Het
Atxn7l3	T	C	11: 102,293,903	D128G	probably damaging	Het
Cacna1h	T	C	17: 25,392,453	Y457C	probably damaging	Het
Ccdc60	A	C	5: 116,172,455	C183G	probably damaging	Het
Cep131	G	A	11: 120,067,185	R772*	probably null	Het
Cnst	C	T	1: 179,579,714	P109S	probably benign	Het
Crtc2	G	T	3: 90,262,570	L509F	probably damaging	Het
Ctsr	A	T	13: 61,161,936	I153N	possibly damaging	Het
Dffa	A	T	4: 149,104,251	M1L	possibly damaging	Het
Dnajc16	G	A	4: 141,763,653	R729*	probably null	Het
Eef2k	T	A	7: 120,899,371	C91*	probably null	Het
Eml5	T	C	12: 98,816,024	D1336G	probably damaging	Het
F12	G	A	13: 55,421,222		probably null	Het
Fam43b	G	C	4: 138,395,098	R304G	probably benign	Het
Fbxo40	A	T	16: 36,969,083	L555Q	probably damaging	Het
Frmpd1	T	C	4: 45,283,698	S840P	probably damaging	Het
Gadd45a	C	T	6: 67,037,005		probably null	Het
Galnt7	T	C	8: 57,532,624		probably benign	Het
Gm5592	G	A	7: 41,157,835		probably benign	Het
Gpr171	T	C	3: 59,098,085	T90A	probably damaging	Het
Gpr82	A	T	X: 13,665,338	T42S	probably benign	Het
H2-M10.6	T	A	17: 36,812,504	I30N	probably benign	Het
Hk2	T	C	6: 82,736,676	E447G	possibly damaging	Het
Hspa4l	C	A	3: 40,785,389	H698Q	probably benign	Het
Idi1	G	T	13: 8,885,932	A25S	probably benign	Het
Kdm4a	C	T	4: 118,153,231	R605H	probably damaging	Het
Nhlrc2	T	C	19: 56,588,271		probably null	Het
Nt5c2	A	G	19: 46,896,518	V252A	probably damaging	Het
Olfr608	T	A	7: 103,470,660	V207E	probably damaging	Het
Pbp2	A	G	6: 135,310,145	L68P	probably benign	Het
Pcnx3	G	T	19: 5,678,967	T547K	probably benign	Het
Ppp1r12a	T	C	10: 108,253,501		probably benign	Het
Prmt9	G	A	8: 77,568,265	V413I	probably benign	Het
Pudp	T	C	18: 50,568,053	N203S	probably benign	Het
Rnf213	T	C	11: 119,480,939		probably benign	Het
Sall3	G	A	18: 80,972,502	T737M	probably damaging	Het
Scn2b	A	G	9: 45,125,461	N89S	possibly damaging	Het
Sgsm1	A	G	5: 113,263,259	V580A	probably benign	Het
Slc13a4	C	A	6: 35,271,604		probably null	Het
Slc4a4	A	C	5: 89,232,839	S1015R	probably benign	Het
Slc8a1	T	C	17: 81,648,374	T412A	probably benign	Het
Spag17	A	T	3: 100,106,759	D2116V	probably damaging	Het
Trim55	T	C	3: 19,672,956	F396L	probably benign	Het
Vmn1r189	A	T	13: 22,102,269	F133I	possibly damaging	Het
Zfp735	T	C	11: 73,711,456	S409P	probably benign	Het

Other mutations in Usp54

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00585:Usp54	APN	14	20573837	missense	probably damaging	1.00
IGL01090:Usp54	APN	14	20586157	unclassified	probably benign
IGL02030:Usp54	APN	14	20565946	missense	probably benign	0.44
IGL02333:Usp54	APN	14	20589395	missense	probably damaging	1.00
IGL02642:Usp54	APN	14	20565072	splice site	probably benign
IGL02970:Usp54	APN	14	20577472	missense	probably damaging	1.00
IGL03371:Usp54	APN	14	20589368	unclassified	probably benign
BB003:Usp54	UTSW	14	20576968	missense	probably damaging	1.00
BB013:Usp54	UTSW	14	20576968	missense	probably damaging	1.00
R0050:Usp54	UTSW	14	20573755	unclassified	probably benign
R0383:Usp54	UTSW	14	20561252	missense	probably benign	0.00
R0427:Usp54	UTSW	14	20570364	missense	probably benign
R0442:Usp54	UTSW	14	20607209	missense	probably damaging	1.00
R0574:Usp54	UTSW	14	20556254	missense	probably benign	0.00
R0638:Usp54	UTSW	14	20589369	unclassified	probably benign
R0789:Usp54	UTSW	14	20562157	missense	probably benign	0.01
R1272:Usp54	UTSW	14	20561110	missense	probably damaging	0.99
R1463:Usp54	UTSW	14	20550190	missense	probably benign	0.15
R1565:Usp54	UTSW	14	20607159	missense	probably damaging	1.00
R1721:Usp54	UTSW	14	20583440	nonsense	probably null
R1922:Usp54	UTSW	14	20560904	missense	probably benign	0.00
R2068:Usp54	UTSW	14	20577205	missense	probably damaging	1.00
R2216:Usp54	UTSW	14	20561840	missense	probably benign
R2285:Usp54	UTSW	14	20561178	missense	possibly damaging	0.52
R2426:Usp54	UTSW	14	20564940	missense	probably benign	0.00
R3855:Usp54	UTSW	14	20588420	missense	probably damaging	1.00
R3907:Usp54	UTSW	14	20586113	missense	probably damaging	1.00
R4367:Usp54	UTSW	14	20561134	missense	probably benign	0.02
R4384:Usp54	UTSW	14	20550085	splice site	probably null
R4555:Usp54	UTSW	14	20561022	missense	probably benign	0.06
R4617:Usp54	UTSW	14	20550338	missense	probably benign	0.04
R4659:Usp54	UTSW	14	20564992	missense	probably damaging	1.00
R4672:Usp54	UTSW	14	20581529	intron	probably benign
R4928:Usp54	UTSW	14	20562192	missense	probably damaging	1.00
R5381:Usp54	UTSW	14	20586076	missense	probably damaging	1.00
R5408:Usp54	UTSW	14	20550433	missense	probably damaging	1.00
R5630:Usp54	UTSW	14	20565057	missense	probably damaging	1.00
R5841:Usp54	UTSW	14	20550283	missense	probably benign	0.04
R5886:Usp54	UTSW	14	20561842	missense	probably benign	0.28
R5922:Usp54	UTSW	14	20552071	splice site	probably null
R5975:Usp54	UTSW	14	20583351	missense	possibly damaging	0.77
R6074:Usp54	UTSW	14	20552099	missense	probably benign	0.02
R6183:Usp54	UTSW	14	20552245	missense	probably damaging	0.99
R6234:Usp54	UTSW	14	20583450	missense	probably damaging	1.00
R6303:Usp54	UTSW	14	20560968	missense	possibly damaging	0.95
R6304:Usp54	UTSW	14	20560968	missense	possibly damaging	0.95
R6695:Usp54	UTSW	14	20560869	missense	possibly damaging	0.94
R6774:Usp54	UTSW	14	20577228	missense	probably damaging	1.00
R6941:Usp54	UTSW	14	20562109	missense	probably benign
R7133:Usp54	UTSW	14	20561242	missense	probably benign	0.00
R7196:Usp54	UTSW	14	20588370	missense	probably damaging	1.00
R7409:Usp54	UTSW	14	20552245	missense	probably damaging	0.99
R7424:Usp54	UTSW	14	20577040	missense	probably benign	0.15
R7859:Usp54	UTSW	14	20588136	missense	probably benign	0.24
R7926:Usp54	UTSW	14	20576968	missense	probably damaging	1.00
R7954:Usp54	UTSW	14	20561913	missense	probably benign	0.01
R8489:Usp54	UTSW	14	20561536	missense	probably benign	0.31
R8745:Usp54	UTSW	14	20562108	missense	probably benign	0.00
R8775:Usp54	UTSW	14	20588398	missense	probably benign	0.03
R8775-TAIL:Usp54	UTSW	14	20588398	missense	probably benign	0.03
R9080:Usp54	UTSW	14	20562240	missense	probably damaging	1.00
R9121:Usp54	UTSW	14	20581455	critical splice donor site	probably null
R9139:Usp54	UTSW	14	20577094	missense	probably benign	0.00
R9433:Usp54	UTSW	14	20561610	missense	probably benign
RF004:Usp54	UTSW	14	20561300	missense	possibly damaging	0.90
X0024:Usp54	UTSW	14	20577251	small deletion	probably benign

Predicted Primers

PCR Primer
(F):5'- GGTCAGACATTCCTACCTGC -3'
(R):5'- TGTAGGGCACTGAGACTAGTC -3'

Sequencing Primer
(F):5'- CCTACCTGCTCTGCAACAATG -3'
(R):5'- GAGACTGGTCTACATAGCAAGTTCC -3'

Posted On

2015-04-06