Incidental Mutation 'R3856:Apex1'
ID276182
Institutional Source Beutler Lab
Gene Symbol Apex1
Ensembl Gene ENSMUSG00000035960
Gene Nameapurinic/apyrimidinic endonuclease 1
SynonymsHAP1, Ref-1
MMRRC Submission 040902-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3856 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50924968-50927139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50926257 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 109 (T109A)
Ref Sequence ENSEMBL: ENSMUSP00000116319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006452] [ENSMUST00000049312] [ENSMUST00000049411] [ENSMUST00000128395] [ENSMUST00000136753] [ENSMUST00000154288] [ENSMUST00000159292] [ENSMUST00000160375] [ENSMUST00000160393] [ENSMUST00000160538] [ENSMUST00000160835] [ENSMUST00000160890] [ENSMUST00000161166] [ENSMUST00000162177] [ENSMUST00000162957] [ENSMUST00000226871]
Predicted Effect probably benign
Transcript: ENSMUST00000006452
SMART Domains Protein: ENSMUSP00000006452
Gene: ENSMUSG00000006289

DomainStartEndE-ValueType
Pfam:Peptidase_M22 23 186 1.1e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049312
SMART Domains Protein: ENSMUSP00000038276
Gene: ENSMUSG00000035953

DomainStartEndE-ValueType
Pfam:Tmemb_55A 1 270 9.8e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049411
AA Change: T114A

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000042602
Gene: ENSMUSG00000035960
AA Change: T114A

DomainStartEndE-ValueType
low complexity region 14 40 N/A INTRINSIC
Pfam:Exo_endo_phos 64 308 1.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128395
AA Change: T109A

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116319
Gene: ENSMUSG00000035960
AA Change: T109A

DomainStartEndE-ValueType
low complexity region 9 35 N/A INTRINSIC
Pfam:Exo_endo_phos 59 280 2.3e-24 PFAM
Pfam:Exo_endo_phos_2 138 284 4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136753
AA Change: T114A

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000123148
Gene: ENSMUSG00000035960
AA Change: T114A

DomainStartEndE-ValueType
low complexity region 14 40 N/A INTRINSIC
Pfam:Exo_endo_phos 64 177 3.8e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000154288
AA Change: T114A
SMART Domains Protein: ENSMUSP00000122343
Gene: ENSMUSG00000035960
AA Change: T114A

DomainStartEndE-ValueType
low complexity region 14 40 N/A INTRINSIC
Pfam:Exo_endo_phos 64 214 1.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159047
Predicted Effect probably benign
Transcript: ENSMUST00000159292
SMART Domains Protein: ENSMUSP00000124039
Gene: ENSMUSG00000006289

DomainStartEndE-ValueType
Pfam:Peptidase_M22 23 301 3.6e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159745
Predicted Effect probably benign
Transcript: ENSMUST00000160375
SMART Domains Protein: ENSMUSP00000124099
Gene: ENSMUSG00000006289

DomainStartEndE-ValueType
Pfam:Peptidase_M22 1 156 1.3e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160393
SMART Domains Protein: ENSMUSP00000125155
Gene: ENSMUSG00000006289

DomainStartEndE-ValueType
Pfam:Peptidase_M22 23 301 3.6e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160464
Predicted Effect probably benign
Transcript: ENSMUST00000160538
SMART Domains Protein: ENSMUSP00000124259
Gene: ENSMUSG00000035953

DomainStartEndE-ValueType
Pfam:Tmemb_55A 1 197 1.9e-82 PFAM
low complexity region 221 235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160835
SMART Domains Protein: ENSMUSP00000124782
Gene: ENSMUSG00000035953

DomainStartEndE-ValueType
Pfam:Tmemb_55A 4 277 2.8e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160890
SMART Domains Protein: ENSMUSP00000124659
Gene: ENSMUSG00000006289

DomainStartEndE-ValueType
Pfam:Peptidase_M22 23 79 1.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161166
SMART Domains Protein: ENSMUSP00000125414
Gene: ENSMUSG00000035953

DomainStartEndE-ValueType
Pfam:Tmemb_55A 1 168 3.6e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161669
Predicted Effect probably benign
Transcript: ENSMUST00000162177
SMART Domains Protein: ENSMUSP00000124016
Gene: ENSMUSG00000006289

DomainStartEndE-ValueType
Pfam:Peptidase_M22 1 220 1.1e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162935
Predicted Effect probably benign
Transcript: ENSMUST00000162957
SMART Domains Protein: ENSMUSP00000123697
Gene: ENSMUSG00000035953

DomainStartEndE-ValueType
Pfam:Tmemb_55A 1 174 2.9e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163043
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163088
Predicted Effect probably benign
Transcript: ENSMUST00000226871
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apurinic/apyrimidinic (AP) sites occur frequently in DNA molecules by spontaneous hydrolysis, by DNA damaging agents or by DNA glycosylases that remove specific abnormal bases. AP sites are pre-mutagenic lesions that can prevent normal DNA replication so the cell contains systems to identify and repair such sites. Class II AP endonucleases cleave the phosphodiester backbone 5' to the AP site. This gene encodes the major AP endonuclease in human cells. Splice variants have been found for this gene; all encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E10 associated with abnormal embryogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T C 14: 103,055,446 S469P possibly damaging Het
Adgrf5 A T 17: 43,447,036 N787I possibly damaging Het
Ank2 T C 3: 126,929,844 T945A probably benign Het
Aox4 T A 1: 58,253,934 I863N probably damaging Het
Ap3d1 A G 10: 80,712,185 I891T probably benign Het
Arhgef1 G A 7: 24,919,272 G107S probably damaging Het
Atxn7l1 A G 12: 33,367,600 T587A probably damaging Het
Atxn7l3 T C 11: 102,293,903 D128G probably damaging Het
Cacna1h T C 17: 25,392,453 Y457C probably damaging Het
Ccdc60 A C 5: 116,172,455 C183G probably damaging Het
Cep131 G A 11: 120,067,185 R772* probably null Het
Cnst C T 1: 179,579,714 P109S probably benign Het
Crtc2 G T 3: 90,262,570 L509F probably damaging Het
Ctsr A T 13: 61,161,936 I153N possibly damaging Het
Dffa A T 4: 149,104,251 M1L possibly damaging Het
Dnajc16 G A 4: 141,763,653 R729* probably null Het
Eef2k T A 7: 120,899,371 C91* probably null Het
Eml5 T C 12: 98,816,024 D1336G probably damaging Het
F12 G A 13: 55,421,222 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fbxo40 A T 16: 36,969,083 L555Q probably damaging Het
Frmpd1 T C 4: 45,283,698 S840P probably damaging Het
Gadd45a C T 6: 67,037,005 probably null Het
Galnt7 T C 8: 57,532,624 probably benign Het
Gm5592 G A 7: 41,157,835 probably benign Het
Gpr171 T C 3: 59,098,085 T90A probably damaging Het
Gpr82 A T X: 13,665,338 T42S probably benign Het
H2-M10.6 T A 17: 36,812,504 I30N probably benign Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Hspa4l C A 3: 40,785,389 H698Q probably benign Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Kdm4a C T 4: 118,153,231 R605H probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Olfr608 T A 7: 103,470,660 V207E probably damaging Het
Pbp2 A G 6: 135,310,145 L68P probably benign Het
Pcnx3 G T 19: 5,678,967 T547K probably benign Het
Ppp1r12a T C 10: 108,253,501 probably benign Het
Prmt9 G A 8: 77,568,265 V413I probably benign Het
Pudp T C 18: 50,568,053 N203S probably benign Het
Rnf213 T C 11: 119,480,939 probably benign Het
Sall3 G A 18: 80,972,502 T737M probably damaging Het
Scn2b A G 9: 45,125,461 N89S possibly damaging Het
Sgsm1 A G 5: 113,263,259 V580A probably benign Het
Slc13a4 C A 6: 35,271,604 probably null Het
Slc4a4 A C 5: 89,232,839 S1015R probably benign Het
Slc8a1 T C 17: 81,648,374 T412A probably benign Het
Spag17 A T 3: 100,106,759 D2116V probably damaging Het
Trim55 T C 3: 19,672,956 F396L probably benign Het
Usp54 C A 14: 20,588,420 M197I probably damaging Het
Vmn1r189 A T 13: 22,102,269 F133I possibly damaging Het
Zfp735 T C 11: 73,711,456 S409P probably benign Het
Other mutations in Apex1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Apex1 APN 14 50926254 missense possibly damaging 0.47
R3855:Apex1 UTSW 14 50926257 missense probably benign 0.13
R4461:Apex1 UTSW 14 50926513 missense probably damaging 0.99
R6014:Apex1 UTSW 14 50925525 missense probably benign 0.00
R6212:Apex1 UTSW 14 50926893 missense probably benign 0.18
R7653:Apex1 UTSW 14 50926538 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATTCTGCTGCTCGAATGCC -3'
(R):5'- ACCCGGCCTTCTTGATCATG -3'

Sequencing Primer
(F):5'- AATGCCTTCTGTGTATAGCATGTAGC -3'
(R):5'- CTCGCCTATAAAAATAAAAACCAGTG -3'
Posted On2015-04-06