Incidental Mutation 'R3857:Pth2r'
ID276197
Institutional Source Beutler Lab
Gene Symbol Pth2r
Ensembl Gene ENSMUSG00000025946
Gene Nameparathyroid hormone 2 receptor
SynonymsPthr2
MMRRC Submission 040785-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3857 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location65282056-65389244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65322047 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 52 (I52F)
Ref Sequence ENSEMBL: ENSMUSP00000027083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027083] [ENSMUST00000140190]
Predicted Effect probably damaging
Transcript: ENSMUST00000027083
AA Change: I52F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027083
Gene: ENSMUSG00000025946
AA Change: I52F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
HormR 59 134 8.15e-28 SMART
Pfam:7tm_2 139 406 5.1e-81 PFAM
low complexity region 447 461 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140190
AA Change: I47F

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114594
Gene: ENSMUSG00000025946
AA Change: I47F

DomainStartEndE-ValueType
HormR 54 129 8.15e-28 SMART
Pfam:7tm_2 134 174 1.1e-13 PFAM
Meta Mutation Damage Score 0.0946 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor 2 family. This protein is a receptor for parathyroid hormone (PTH). This receptor is more selective in ligand recognition and has a more specific tissue distribution compared to parathyroid hormone receptor 1 (PTHR1). It is activated only by PTH and not by parathyroid hormone-like hormone (PTHLH) and is particularly abundant in brain and pancreas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AU022751 A G X: 6,082,656 S102P possibly damaging Het
Bdkrb2 T C 12: 105,592,439 V313A probably benign Het
Ccng1 A G 11: 40,753,833 L79P probably damaging Het
Celf1 A G 2: 91,012,741 E411G probably damaging Het
Cps1 A G 1: 67,168,278 Y582C probably damaging Het
Dnah8 A G 17: 30,663,422 D656G probably damaging Het
Erc2 A G 14: 28,475,642 probably benign Het
Ercc8 A G 13: 108,194,114 E395G possibly damaging Het
F13a1 A G 13: 37,025,694 L99P probably benign Het
Fzd3 A T 14: 65,239,839 C89S possibly damaging Het
Gm2075 T A 12: 88,012,246 D133E unknown Het
Gse1 T A 8: 120,571,133 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs3st1 G A 5: 39,614,913 T129I probably damaging Het
Irx1 A T 13: 71,963,458 Y11N possibly damaging Het
Kdm3b T A 18: 34,833,387 I1658N probably benign Het
Mtmr4 G A 11: 87,597,262 V24M probably damaging Het
Nfatc1 T C 18: 80,665,275 probably benign Het
Obscn A G 11: 59,080,969 probably benign Het
Pcna A T 2: 132,249,621 S261T probably benign Het
Pigr T C 1: 130,847,261 V475A probably benign Het
Pitpnc1 T C 11: 107,320,805 probably null Het
Psph A G 5: 129,771,476 M47T probably damaging Het
Rtn4rl2 A G 2: 84,880,386 probably null Het
Senp6 A G 9: 80,092,321 T7A possibly damaging Het
Slc4a1 A T 11: 102,357,121 V349E probably benign Het
Spice1 T C 16: 44,355,443 S2P probably damaging Het
Spty2d1 G A 7: 46,998,296 T295I probably benign Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Togaram1 A G 12: 64,980,859 Q874R possibly damaging Het
Ttn T A 2: 76,908,975 D3740V probably benign Het
Unc13c G T 9: 73,699,108 Y1323* probably null Het
Vmn1r19 A T 6: 57,405,113 Y217F possibly damaging Het
Zfp101 G T 17: 33,382,431 S79* probably null Het
Zfp512 G T 5: 31,472,840 R222L probably damaging Het
Zfyve16 A T 13: 92,494,971 I1372N probably damaging Het
Other mutations in Pth2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Pth2r APN 1 65388725 missense probably benign 0.08
IGL02054:Pth2r APN 1 65336781 missense probably damaging 1.00
IGL02429:Pth2r APN 1 65346839 missense probably benign 0.05
R0277:Pth2r UTSW 1 65388616 missense probably benign
R0323:Pth2r UTSW 1 65388616 missense probably benign
R0415:Pth2r UTSW 1 65388439 missense probably benign
R1067:Pth2r UTSW 1 65372348 missense possibly damaging 0.92
R1463:Pth2r UTSW 1 65363277 missense probably damaging 0.96
R1566:Pth2r UTSW 1 65388538 missense possibly damaging 0.50
R1690:Pth2r UTSW 1 65372303 missense probably benign 0.02
R1710:Pth2r UTSW 1 65336838 missense possibly damaging 0.48
R1957:Pth2r UTSW 1 65372355 missense probably damaging 1.00
R2062:Pth2r UTSW 1 65343562 missense probably damaging 1.00
R2232:Pth2r UTSW 1 65336769 missense probably damaging 1.00
R2942:Pth2r UTSW 1 65388476 missense probably benign 0.00
R3011:Pth2r UTSW 1 65336988 missense probably benign 0.05
R3858:Pth2r UTSW 1 65322047 missense probably damaging 0.98
R3859:Pth2r UTSW 1 65322047 missense probably damaging 0.98
R4540:Pth2r UTSW 1 65282201 missense probably benign
R4694:Pth2r UTSW 1 65336761 missense probably benign
R4777:Pth2r UTSW 1 65388517 missense possibly damaging 0.90
R4926:Pth2r UTSW 1 65321984 missense probably benign 0.27
R5209:Pth2r UTSW 1 65388697 missense probably benign 0.04
R5871:Pth2r UTSW 1 65388637 missense probably damaging 1.00
R6868:Pth2r UTSW 1 65388479 missense probably benign 0.02
R7132:Pth2r UTSW 1 65322066 missense probably benign 0.00
R7242:Pth2r UTSW 1 65388620 missense probably benign 0.42
R7677:Pth2r UTSW 1 65388446 missense probably benign 0.00
R7836:Pth2r UTSW 1 65351563 missense probably damaging 1.00
R7919:Pth2r UTSW 1 65351563 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTGATGGGGTACTGTTTCA -3'
(R):5'- GCCCAGTTGATGTACTCCAAAA -3'

Sequencing Primer
(F):5'- CCTGATGGGGTACTGTTTCAGTTAG -3'
(R):5'- TACAGAGATGGGAGAACCTTGTCC -3'
Posted On2015-04-06