Incidental Mutation 'R3857:Gse1'
ID276212
Institutional Source Beutler Lab
Gene Symbol Gse1
Ensembl Gene ENSMUSG00000031822
Gene Namegenetic suppressor element 1, coiled-coil protein
Synonyms
MMRRC Submission 040785-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R3857 (G1)
Quality Score173
Status Validated
Chromosome8
Chromosomal Location120228456-120581390 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 120571133 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034279] [ENSMUST00000118136] [ENSMUST00000120493] [ENSMUST00000127664]
Predicted Effect unknown
Transcript: ENSMUST00000034279
AA Change: I695N
SMART Domains Protein: ENSMUSP00000034279
Gene: ENSMUSG00000031822
AA Change: I695N

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
Pfam:DUF3736 81 216 2.9e-21 PFAM
coiled coil region 329 414 N/A INTRINSIC
Pfam:DUF3736 742 883 9.7e-46 PFAM
low complexity region 959 973 N/A INTRINSIC
low complexity region 1103 1124 N/A INTRINSIC
coiled coil region 1133 1207 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000118136
AA Change: I685N
SMART Domains Protein: ENSMUSP00000112981
Gene: ENSMUSG00000031822
AA Change: I685N

DomainStartEndE-ValueType
low complexity region 51 63 N/A INTRINSIC
Pfam:DUF3736 70 203 2.2e-39 PFAM
low complexity region 204 211 N/A INTRINSIC
coiled coil region 319 404 N/A INTRINSIC
Pfam:DUF3736 731 874 7.5e-48 PFAM
low complexity region 949 963 N/A INTRINSIC
low complexity region 1093 1114 N/A INTRINSIC
coiled coil region 1123 1197 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000120493
AA Change: I682N
SMART Domains Protein: ENSMUSP00000113577
Gene: ENSMUSG00000031822
AA Change: I682N

DomainStartEndE-ValueType
low complexity region 48 60 N/A INTRINSIC
Pfam:DUF3736 67 200 2.2e-39 PFAM
low complexity region 201 208 N/A INTRINSIC
coiled coil region 316 401 N/A INTRINSIC
Pfam:DUF3736 728 871 7.5e-48 PFAM
low complexity region 946 960 N/A INTRINSIC
low complexity region 1090 1111 N/A INTRINSIC
coiled coil region 1120 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147327
Meta Mutation Damage Score 0.0771 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AU022751 A G X: 6,082,656 S102P possibly damaging Het
Bdkrb2 T C 12: 105,592,439 V313A probably benign Het
Ccng1 A G 11: 40,753,833 L79P probably damaging Het
Celf1 A G 2: 91,012,741 E411G probably damaging Het
Cps1 A G 1: 67,168,278 Y582C probably damaging Het
Dnah8 A G 17: 30,663,422 D656G probably damaging Het
Erc2 A G 14: 28,475,642 probably benign Het
Ercc8 A G 13: 108,194,114 E395G possibly damaging Het
F13a1 A G 13: 37,025,694 L99P probably benign Het
Fzd3 A T 14: 65,239,839 C89S possibly damaging Het
Gm2075 T A 12: 88,012,246 D133E unknown Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs3st1 G A 5: 39,614,913 T129I probably damaging Het
Irx1 A T 13: 71,963,458 Y11N possibly damaging Het
Kdm3b T A 18: 34,833,387 I1658N probably benign Het
Mtmr4 G A 11: 87,597,262 V24M probably damaging Het
Nfatc1 T C 18: 80,665,275 probably benign Het
Obscn A G 11: 59,080,969 probably benign Het
Pcna A T 2: 132,249,621 S261T probably benign Het
Pigr T C 1: 130,847,261 V475A probably benign Het
Pitpnc1 T C 11: 107,320,805 probably null Het
Psph A G 5: 129,771,476 M47T probably damaging Het
Pth2r A T 1: 65,322,047 I52F probably damaging Het
Rtn4rl2 A G 2: 84,880,386 probably null Het
Senp6 A G 9: 80,092,321 T7A possibly damaging Het
Slc4a1 A T 11: 102,357,121 V349E probably benign Het
Spice1 T C 16: 44,355,443 S2P probably damaging Het
Spty2d1 G A 7: 46,998,296 T295I probably benign Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Togaram1 A G 12: 64,980,859 Q874R possibly damaging Het
Ttn T A 2: 76,908,975 D3740V probably benign Het
Unc13c G T 9: 73,699,108 Y1323* probably null Het
Vmn1r19 A T 6: 57,405,113 Y217F possibly damaging Het
Zfp101 G T 17: 33,382,431 S79* probably null Het
Zfp512 G T 5: 31,472,840 R222L probably damaging Het
Zfyve16 A T 13: 92,494,971 I1372N probably damaging Het
Other mutations in Gse1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Gse1 APN 8 120553587 start codon destroyed probably null 0.79
IGL02484:Gse1 APN 8 120575262 intron probably benign
IGL02931:Gse1 APN 8 120578069 intron probably benign
IGL03193:Gse1 APN 8 120571340 critical splice donor site probably null
R0027:Gse1 UTSW 8 120566546 intron probably benign
R0109:Gse1 UTSW 8 120567785 missense probably damaging 1.00
R0257:Gse1 UTSW 8 120572334 intron probably benign
R0967:Gse1 UTSW 8 120570855 intron probably benign
R1395:Gse1 UTSW 8 120574999 intron probably benign
R1480:Gse1 UTSW 8 120572394 intron probably benign
R1532:Gse1 UTSW 8 120568210 intron probably benign
R1649:Gse1 UTSW 8 120578515 intron probably benign
R1728:Gse1 UTSW 8 120568253 intron probably benign
R1742:Gse1 UTSW 8 120566950 missense probably damaging 1.00
R1784:Gse1 UTSW 8 120568253 intron probably benign
R2081:Gse1 UTSW 8 120566480 missense probably damaging 1.00
R2110:Gse1 UTSW 8 120566980 missense probably damaging 1.00
R2974:Gse1 UTSW 8 120570897 intron probably benign
R3615:Gse1 UTSW 8 120572742 intron probably benign
R3616:Gse1 UTSW 8 120572742 intron probably benign
R4201:Gse1 UTSW 8 120567764 missense probably benign 0.39
R4494:Gse1 UTSW 8 120570814 intron probably benign
R4857:Gse1 UTSW 8 120572757 intron probably benign
R4911:Gse1 UTSW 8 120568466 intron probably benign
R5640:Gse1 UTSW 8 120562677 missense possibly damaging 0.65
R5782:Gse1 UTSW 8 120566521 missense probably damaging 1.00
R5980:Gse1 UTSW 8 120229637 intron probably benign
R6090:Gse1 UTSW 8 120571169 intron probably benign
R6156:Gse1 UTSW 8 120489127 missense possibly damaging 0.95
R6191:Gse1 UTSW 8 120553803 critical splice donor site probably null
R6270:Gse1 UTSW 8 120569163 intron probably benign
R6502:Gse1 UTSW 8 120553689 unclassified probably null
R6573:Gse1 UTSW 8 120567797 missense probably damaging 1.00
R6885:Gse1 UTSW 8 120229482 intron probably benign
R6901:Gse1 UTSW 8 120229822 intron probably benign
R6959:Gse1 UTSW 8 120570971 intron probably benign
R7023:Gse1 UTSW 8 120230648 intron probably benign
R7210:Gse1 UTSW 8 120230702 missense unknown
R7263:Gse1 UTSW 8 120574171 missense unknown
R7449:Gse1 UTSW 8 120229711 missense unknown
R7602:Gse1 UTSW 8 120569304 missense unknown
R7627:Gse1 UTSW 8 120572777 missense unknown
R7635:Gse1 UTSW 8 120572895 missense unknown
R7689:Gse1 UTSW 8 120568478 missense unknown
X0026:Gse1 UTSW 8 120568163 nonsense probably null
Z1177:Gse1 UTSW 8 120229852 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGCCACCCGACTGCTTTTG -3'
(R):5'- GTTCCTCCAGGTCCAGTTTG -3'

Sequencing Primer
(F):5'- GACTGCTTTTGAGCCCAGC -3'
(R):5'- AGGTCCAGTTTGCTGACCAG -3'
Posted On2015-04-06