Incidental Mutation 'R3857:Erc2'
ID 276227
Institutional Source Beutler Lab
Gene Symbol Erc2
Ensembl Gene ENSMUSG00000040640
Gene Name ELKS/RAB6-interacting/CAST family member 2
Synonyms ELKS2alpha, D14Ertd171e
MMRRC Submission 040785-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3857 (G1)
Quality Score 213
Status Validated
Chromosome 14
Chromosomal Location 27622428-28478537 bp(+) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) A to G at 28475642 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090302] [ENSMUST00000210135] [ENSMUST00000210924]
AlphaFold Q6PH08
Predicted Effect unknown
Transcript: ENSMUST00000090302
AA Change: S959G
SMART Domains Protein: ENSMUSP00000087773
Gene: ENSMUSG00000040640
AA Change: S959G

DomainStartEndE-ValueType
low complexity region 14 45 N/A INTRINSIC
low complexity region 121 133 N/A INTRINSIC
Pfam:Cast 150 907 N/A PFAM
low complexity region 916 928 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209800
Predicted Effect probably benign
Transcript: ENSMUST00000210135
Predicted Effect probably benign
Transcript: ENSMUST00000210924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224045
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Rab3-interacting molecule (RIM)-binding protein family. Members of this protein family form part of the cytomatrix at the active zone (CAZ) complex and function as regulators of neurotransmitter release. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for targeted disruptions of this gene are viable and fertile. However, homozygotes for one allele display abnormal CNS synaptic transmission. Homozygotes for a second allele display retinal abnormalities and impaired vision. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AU022751 A G X: 6,082,656 S102P possibly damaging Het
Bdkrb2 T C 12: 105,592,439 V313A probably benign Het
Ccng1 A G 11: 40,753,833 L79P probably damaging Het
Celf1 A G 2: 91,012,741 E411G probably damaging Het
Cps1 A G 1: 67,168,278 Y582C probably damaging Het
Dnah8 A G 17: 30,663,422 D656G probably damaging Het
Ercc8 A G 13: 108,194,114 E395G possibly damaging Het
F13a1 A G 13: 37,025,694 L99P probably benign Het
Fzd3 A T 14: 65,239,839 C89S possibly damaging Het
Gm2075 T A 12: 88,012,246 D133E unknown Het
Gse1 T A 8: 120,571,133 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs3st1 G A 5: 39,614,913 T129I probably damaging Het
Irx1 A T 13: 71,963,458 Y11N possibly damaging Het
Kdm3b T A 18: 34,833,387 I1658N probably benign Het
Mtmr4 G A 11: 87,597,262 V24M probably damaging Het
Nfatc1 T C 18: 80,665,275 probably benign Het
Obscn A G 11: 59,080,969 probably benign Het
Pcna A T 2: 132,249,621 S261T probably benign Het
Pigr T C 1: 130,847,261 V475A probably benign Het
Pitpnc1 T C 11: 107,320,805 probably null Het
Psph A G 5: 129,771,476 M47T probably damaging Het
Pth2r A T 1: 65,322,047 I52F probably damaging Het
Rtn4rl2 A G 2: 84,880,386 probably null Het
Senp6 A G 9: 80,092,321 T7A possibly damaging Het
Slc4a1 A T 11: 102,357,121 V349E probably benign Het
Spice1 T C 16: 44,355,443 S2P probably damaging Het
Spty2d1 G A 7: 46,998,296 T295I probably benign Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Togaram1 A G 12: 64,980,859 Q874R possibly damaging Het
Ttn T A 2: 76,908,975 D3740V probably benign Het
Unc13c G T 9: 73,699,108 Y1323* probably null Het
Vmn1r19 A T 6: 57,405,113 Y217F possibly damaging Het
Zfp101 G T 17: 33,382,431 S79* probably null Het
Zfp512 G T 5: 31,472,840 R222L probably damaging Het
Zfyve16 A T 13: 92,494,971 I1372N probably damaging Het
Other mutations in Erc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Erc2 APN 14 28040521 missense probably damaging 0.98
IGL01862:Erc2 APN 14 28271569 splice site probably benign
IGL01906:Erc2 APN 14 28141306 missense probably damaging 0.99
IGL02177:Erc2 APN 14 27898623 missense probably benign 0.00
IGL02481:Erc2 APN 14 27653071 missense probably damaging 1.00
IGL02483:Erc2 APN 14 27653071 missense probably damaging 1.00
IGL02623:Erc2 APN 14 27776980 missense probably damaging 1.00
IGL03252:Erc2 APN 14 28475649 utr 3 prime probably benign
IGL03378:Erc2 APN 14 28011723 missense probably damaging 1.00
lobe UTSW 14 28317251 missense probably damaging 0.96
R0091:Erc2 UTSW 14 27776824 critical splice acceptor site probably null
R0309:Erc2 UTSW 14 28141225 missense probably damaging 0.98
R0357:Erc2 UTSW 14 27777022 missense probably damaging 0.99
R0378:Erc2 UTSW 14 28011694 missense probably damaging 1.00
R0550:Erc2 UTSW 14 28271651 missense possibly damaging 0.74
R0815:Erc2 UTSW 14 28025148 missense probably benign 0.04
R0863:Erc2 UTSW 14 28025148 missense probably benign 0.04
R1121:Erc2 UTSW 14 28475655 utr 3 prime probably benign
R1164:Erc2 UTSW 14 28302972 missense probably damaging 0.99
R1498:Erc2 UTSW 14 28302898 missense probably benign 0.27
R1500:Erc2 UTSW 14 28271660 missense probably damaging 0.98
R1555:Erc2 UTSW 14 28011665 missense probably damaging 0.99
R1894:Erc2 UTSW 14 28141228 missense probably damaging 0.99
R1950:Erc2 UTSW 14 27912900 missense probably damaging 0.99
R1991:Erc2 UTSW 14 28011636 missense probably benign 0.34
R2698:Erc2 UTSW 14 28271705 missense probably benign 0.06
R2847:Erc2 UTSW 14 28040488 missense probably damaging 0.97
R3015:Erc2 UTSW 14 28011775 critical splice donor site probably null
R3612:Erc2 UTSW 14 27777177 missense possibly damaging 0.69
R3759:Erc2 UTSW 14 28025163 missense possibly damaging 0.94
R3858:Erc2 UTSW 14 28475642 utr 3 prime probably benign
R3859:Erc2 UTSW 14 28475642 utr 3 prime probably benign
R4556:Erc2 UTSW 14 28302904 missense probably damaging 1.00
R4739:Erc2 UTSW 14 27776881 missense probably damaging 1.00
R4898:Erc2 UTSW 14 27653328 missense probably damaging 1.00
R5068:Erc2 UTSW 14 28302943 missense possibly damaging 0.63
R5113:Erc2 UTSW 14 27652872 missense probably benign 0.40
R5418:Erc2 UTSW 14 27966510 missense probably benign 0.14
R5741:Erc2 UTSW 14 28302869 splice site probably null
R5819:Erc2 UTSW 14 28141369 missense probably damaging 0.97
R5930:Erc2 UTSW 14 27776858 missense probably damaging 0.99
R6073:Erc2 UTSW 14 28011636 missense probably benign 0.00
R6150:Erc2 UTSW 14 28141291 missense probably damaging 0.97
R6182:Erc2 UTSW 14 28317253 missense probably damaging 0.99
R6188:Erc2 UTSW 14 28317251 missense probably damaging 0.96
R6267:Erc2 UTSW 14 28080155 missense probably damaging 1.00
R6296:Erc2 UTSW 14 28080155 missense probably damaging 1.00
R6730:Erc2 UTSW 14 27898567 missense possibly damaging 0.95
R6969:Erc2 UTSW 14 27898596 missense probably damaging 1.00
R7095:Erc2 UTSW 14 27898593 missense probably damaging 0.99
R7221:Erc2 UTSW 14 27653158 missense probably damaging 0.97
R7365:Erc2 UTSW 14 28040389 missense probably damaging 1.00
R7454:Erc2 UTSW 14 28302991 missense possibly damaging 0.92
R7763:Erc2 UTSW 14 27876204 critical splice donor site probably null
R7784:Erc2 UTSW 14 27898594 missense probably damaging 0.96
R7890:Erc2 UTSW 14 28040341 critical splice acceptor site probably null
R7894:Erc2 UTSW 14 27777208 missense probably damaging 1.00
R8031:Erc2 UTSW 14 28011692 missense probably damaging 0.99
R8206:Erc2 UTSW 14 28303015 splice site probably null
R8273:Erc2 UTSW 14 27777139 missense probably benign 0.41
R8304:Erc2 UTSW 14 27653165 missense probably damaging 0.99
R8387:Erc2 UTSW 14 27653296 missense possibly damaging 0.92
R8751:Erc2 UTSW 14 28080188 missense possibly damaging 0.78
R8851:Erc2 UTSW 14 28317259 missense probably null 0.99
R9130:Erc2 UTSW 14 28029461 missense probably benign 0.25
R9292:Erc2 UTSW 14 27776842 missense probably damaging 1.00
R9441:Erc2 UTSW 14 28080157 missense possibly damaging 0.58
R9452:Erc2 UTSW 14 28011733 missense probably damaging 1.00
R9529:Erc2 UTSW 14 28475766 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTGGAAAACGTGACCCCAAC -3'
(R):5'- GATGCTCACTTCGTAAAGGTCC -3'

Sequencing Primer
(F):5'- GTGACCCCAACCAATGAGAGTG -3'
(R):5'- CACTTCGTAAAGGTCCAAATCCTTG -3'
Posted On 2015-04-06